Incidental Mutation 'R2250:Or6b9'
ID 240827
Institutional Source Beutler Lab
Gene Symbol Or6b9
Ensembl Gene ENSMUSG00000036647
Gene Name olfactory receptor family 6 subfamily B member 9
Synonyms MOR103-16, M50, GA_x6K02T2PBJ9-9337331-9336381, Olfr6
MMRRC Submission 040250-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R2250 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 106555191-106556141 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 106555580 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 188 (M188L)
Ref Sequence ENSEMBL: ENSMUSP00000151272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040983] [ENSMUST00000213552] [ENSMUST00000213651] [ENSMUST00000219365]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000040983
AA Change: M188L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000048740
Gene: ENSMUSG00000036647
AA Change: M188L

DomainStartEndE-ValueType
Pfam:7tm_4 29 305 1.5e-58 PFAM
Pfam:7tm_1 39 288 3.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209125
Predicted Effect probably benign
Transcript: ENSMUST00000213552
AA Change: M188L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000213651
AA Change: M188L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000219365
AA Change: M188L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abr A G 11: 76,342,765 (GRCm39) C532R probably damaging Het
Edem2 A C 2: 155,552,893 (GRCm39) probably null Het
Hhatl A G 9: 121,617,237 (GRCm39) V332A possibly damaging Het
Igsf9b G A 9: 27,220,774 (GRCm39) V47I possibly damaging Het
Irf2bp1 G T 7: 18,739,724 (GRCm39) A455S probably benign Het
Lyg2 G A 1: 37,954,816 (GRCm39) L10F probably benign Het
Mcm2 G A 6: 88,869,990 (GRCm39) R60C probably damaging Het
Mindy4 G A 6: 55,277,934 (GRCm39) V593I probably damaging Het
Nectin3 A T 16: 46,275,099 (GRCm39) D319E probably benign Het
Or52e2 C A 7: 102,804,157 (GRCm39) G266C probably damaging Het
Plcb4 G A 2: 135,813,781 (GRCm39) probably null Het
Prkd3 T C 17: 79,275,507 (GRCm39) T446A probably benign Het
Scn11a T A 9: 119,587,668 (GRCm39) T1359S probably benign Het
Skp1 T C 11: 52,134,446 (GRCm39) I59T possibly damaging Het
Sla2 G A 2: 156,717,862 (GRCm39) R137C probably damaging Het
Spta1 A G 1: 174,071,680 (GRCm39) E2220G probably damaging Het
Strn4 A G 7: 16,560,391 (GRCm39) Y181C probably damaging Het
Vmn1r119 A T 7: 20,746,184 (GRCm39) L66H probably damaging Het
Other mutations in Or6b9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Or6b9 APN 7 106,555,634 (GRCm39) missense probably damaging 0.99
IGL02150:Or6b9 APN 7 106,555,763 (GRCm39) missense probably damaging 1.00
IGL02556:Or6b9 APN 7 106,555,598 (GRCm39) missense possibly damaging 0.82
R1550:Or6b9 UTSW 7 106,555,235 (GRCm39) missense probably benign
R1883:Or6b9 UTSW 7 106,555,981 (GRCm39) missense probably benign 0.42
R2069:Or6b9 UTSW 7 106,555,494 (GRCm39) nonsense probably null
R2279:Or6b9 UTSW 7 106,555,834 (GRCm39) missense probably benign 0.00
R5283:Or6b9 UTSW 7 106,555,955 (GRCm39) missense probably benign 0.00
R9700:Or6b9 UTSW 7 106,555,630 (GRCm39) missense probably benign 0.12
R9733:Or6b9 UTSW 7 106,555,846 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCACCACTGTAAGATGAGAAGC -3'
(R):5'- TTAGCTGCCATGGCCTATGATC -3'

Sequencing Primer
(F):5'- CACAGGTGGAGAAGGCCTTC -3'
(R):5'- CCATGGCCTATGATCGTTATGTAGC -3'
Posted On 2014-10-15