Incidental Mutation 'R0165:Ndufs1'
ID24083
Institutional Source Beutler Lab
Gene Symbol Ndufs1
Ensembl Gene ENSMUSG00000025968
Gene NameNADH dehydrogenase (ubiquinone) Fe-S protein 1
Synonyms9930026A05Rik, 5830412M15Rik
MMRRC Submission 038441-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0165 (G1)
Quality Score168
Status Validated
Chromosome1
Chromosomal Location63143596-63176833 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 63159748 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027111] [ENSMUST00000168099] [ENSMUST00000185847] [ENSMUST00000188370]
Predicted Effect probably null
Transcript: ENSMUST00000027111
SMART Domains Protein: ENSMUSP00000027111
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 107 8.5e-20 PFAM
Pfam:Fer2 34 97 1e-11 PFAM
NADH-G_4Fe-4S_3 113 153 6.5e-19 SMART
Pfam:Molybdopterin 301 629 1e-76 PFAM
Pfam:NADH_dhqG_C 658 710 1.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140612
Predicted Effect probably null
Transcript: ENSMUST00000168099
SMART Domains Protein: ENSMUSP00000126621
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 107 4.3e-19 PFAM
Pfam:Fer2 34 97 1e-11 PFAM
NADH-G_4Fe-4S_3 113 153 6.5e-19 SMART
Pfam:Molybdopterin 301 629 1e-76 PFAM
Pfam:DUF1982 657 710 3.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185827
Predicted Effect probably benign
Transcript: ENSMUST00000185847
SMART Domains Protein: ENSMUSP00000141190
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Molybdopterin 1 60 5.7e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188370
SMART Domains Protein: ENSMUSP00000139664
Gene: ENSMUSG00000025968

DomainStartEndE-ValueType
Pfam:Fer2_4 29 96 1.1e-13 PFAM
Pfam:Fer2 34 127 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188602
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.2%
  • 20x: 91.4%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the complex I 75 kDa subunit family. Mammalian complex I is composed of 45 different subunits. It locates at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. This protein is the largest subunit of complex I and it is a component of the iron-sulfur (IP) fragment of the enzyme. It may form part of the active site crevice where NADH is oxidized. Mutations in this gene are associated with complex I deficiency. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,216,382 V1413M probably damaging Het
2700049A03Rik T C 12: 71,167,150 I717T possibly damaging Het
3632451O06Rik A G 14: 49,773,786 S155P probably benign Het
6430571L13Rik A G 9: 107,346,184 probably benign Het
Abca15 T A 7: 120,350,903 probably benign Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Adgrl2 A G 3: 148,852,863 probably benign Het
Agap3 A G 5: 24,479,745 T544A probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Akr1c20 T C 13: 4,523,296 T7A probably benign Het
Ankrd26 A G 6: 118,540,484 S459P probably benign Het
Ascc3 T A 10: 50,842,127 probably null Het
Brd1 T C 15: 88,729,777 N305S probably damaging Het
Catip T A 1: 74,368,469 L320Q possibly damaging Het
Cttnbp2 G A 6: 18,435,410 Q150* probably null Het
Cyp2d22 T G 15: 82,373,280 N228T probably benign Het
Dapk1 T C 13: 60,761,593 V1340A probably benign Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Ddhd1 G A 14: 45,595,592 T849M probably damaging Het
Dnah6 A G 6: 73,021,323 S3987P probably benign Het
Dst C A 1: 34,154,646 probably benign Het
Epha2 T C 4: 141,321,892 probably null Het
Ern2 T C 7: 122,179,779 T281A probably benign Het
Extl1 A G 4: 134,357,703 F652S probably damaging Het
Gckr A G 5: 31,326,948 S541G possibly damaging Het
Gdap1l1 A G 2: 163,451,499 probably null Het
Gm7535 T C 17: 17,911,175 probably benign Het
Gmps T A 3: 63,993,954 I398N probably damaging Het
Igf2r A G 17: 12,698,527 V1556A probably benign Het
Il3ra T A 14: 14,350,967 N283K probably benign Het
Ist1 A G 8: 109,675,366 probably benign Het
Lama3 A T 18: 12,524,810 I1934F probably damaging Het
Lars A T 18: 42,202,697 M1118K possibly damaging Het
Lpin2 C T 17: 71,246,519 S846L probably damaging Het
Lrrc4b C A 7: 44,462,315 T537K probably damaging Het
Ltn1 G A 16: 87,405,519 probably benign Het
Meiob A G 17: 24,835,161 T401A probably benign Het
Mettl21e G A 1: 44,211,123 T41M probably damaging Het
Miga1 C T 3: 152,290,843 E323K probably damaging Het
Olfr486 T C 7: 108,172,675 D23G probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parp6 T C 9: 59,632,925 Y274H probably damaging Het
Prom2 A T 2: 127,539,514 probably benign Het
Prune2 T A 19: 17,122,610 M1826K probably benign Het
Qk T A 17: 10,238,963 D159V probably damaging Het
Rab12 A T 17: 66,500,317 I139N probably damaging Het
Rab25 T A 3: 88,548,055 E7D probably benign Het
Rala A T 13: 17,888,589 V139E probably benign Het
Ralgapa2 A G 2: 146,388,487 probably benign Het
Rbl2 T A 8: 91,074,176 Y89N probably damaging Het
Rho A T 6: 115,932,227 I75F probably damaging Het
Slc38a4 C A 15: 97,008,949 A303S probably benign Het
Slc6a15 A G 10: 103,409,809 D551G probably null Het
Smyd3 T C 1: 179,043,872 N314S probably benign Het
Speer4f1 T A 5: 17,479,514 L180* probably null Het
Stat6 T C 10: 127,657,227 V576A probably damaging Het
Strn T C 17: 78,677,374 D127G possibly damaging Het
Syne1 T C 10: 5,033,096 R8610G probably benign Het
Tbc1d7 A C 13: 43,153,202 probably null Het
Tcf3 C T 10: 80,412,997 R548Q probably damaging Het
Tlr9 C A 9: 106,226,087 A859D probably benign Het
Tmem106c T A 15: 97,968,139 probably benign Het
Tmprss11c A T 5: 86,231,927 probably benign Het
Tnfsf18 A G 1: 161,494,731 R7G probably benign Het
Tnrc6b T A 15: 80,858,670 probably null Het
Trpm7 A T 2: 126,797,513 F1684I probably damaging Het
Ttbk1 C A 17: 46,478,938 R133L possibly damaging Het
Ttn A G 2: 76,721,342 S22962P probably damaging Het
Ube2q1 T A 3: 89,776,153 L135Q probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vwce T C 19: 10,659,973 probably benign Het
Wdhd1 A G 14: 47,267,068 S350P probably benign Het
Zbtb21 A G 16: 97,951,404 S560P probably damaging Het
Other mutations in Ndufs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Ndufs1 APN 1 63164817 missense probably damaging 0.99
IGL01655:Ndufs1 APN 1 63151557 missense probably damaging 1.00
IGL02532:Ndufs1 APN 1 63170139 missense probably damaging 0.99
IGL02606:Ndufs1 APN 1 63159852 missense probably damaging 1.00
IGL02866:Ndufs1 APN 1 63147141 missense probably benign 0.00
IGL03036:Ndufs1 APN 1 63163696 nonsense probably null
IGL03209:Ndufs1 APN 1 63164737 missense probably damaging 1.00
PIT4142001:Ndufs1 UTSW 1 63159748 unclassified probably benign
R0505:Ndufs1 UTSW 1 63143926 splice site probably benign
R1861:Ndufs1 UTSW 1 63147417 missense probably benign 0.17
R2294:Ndufs1 UTSW 1 63160996 missense probably damaging 1.00
R2872:Ndufs1 UTSW 1 63164723 splice site probably benign
R2873:Ndufs1 UTSW 1 63164723 splice site probably benign
R4092:Ndufs1 UTSW 1 63157246 missense possibly damaging 0.55
R4277:Ndufs1 UTSW 1 63170097 missense possibly damaging 0.84
R4782:Ndufs1 UTSW 1 63160949 missense probably damaging 1.00
R4799:Ndufs1 UTSW 1 63160949 missense probably damaging 1.00
R4993:Ndufs1 UTSW 1 63163776 missense probably benign
R5051:Ndufs1 UTSW 1 63164947 critical splice donor site probably null
R5412:Ndufs1 UTSW 1 63166349 missense possibly damaging 0.79
R5632:Ndufs1 UTSW 1 63150059 missense probably benign 0.00
R5705:Ndufs1 UTSW 1 63147158 missense probably benign 0.05
R5854:Ndufs1 UTSW 1 63147389 missense probably benign 0.05
R5919:Ndufs1 UTSW 1 63143832 makesense probably null
R6598:Ndufs1 UTSW 1 63164950 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTCATATCAGCCCTGACAGAACAA -3'
(R):5'- TGCTGCCACCATCCCTGTGT -3'

Sequencing Primer
(F):5'- tcagtggcagaggcagg -3'
(R):5'- GCTTATGATGGACTAAAACGTCAAAG -3'
Posted On2013-04-16