Incidental Mutation 'R2250:Abr'
ID240834
Institutional Source Beutler Lab
Gene Symbol Abr
Ensembl Gene ENSMUSG00000017631
Gene Nameactive BCR-related gene
Synonyms6330400K15Rik
MMRRC Submission 040250-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R2250 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location76416734-76622314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76451939 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 532 (C532R)
Ref Sequence ENSEMBL: ENSMUSP00000104045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065028] [ENSMUST00000072740] [ENSMUST00000094012] [ENSMUST00000108407] [ENSMUST00000108408]
Predicted Effect probably damaging
Transcript: ENSMUST00000065028
AA Change: C351R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068982
Gene: ENSMUSG00000017631
AA Change: C351R

DomainStartEndE-ValueType
Pfam:RhoGEF 12 65 5.4e-11 PFAM
PH 84 243 1.58e-11 SMART
C2 287 394 1.88e-11 SMART
RhoGAP 440 619 6.57e-67 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000072740
AA Change: C569R

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072522
Gene: ENSMUSG00000017631
AA Change: C569R

DomainStartEndE-ValueType
RhoGEF 95 283 2.37e-56 SMART
PH 302 461 1.58e-11 SMART
C2 505 612 1.88e-11 SMART
RhoGAP 658 837 6.57e-67 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094012
AA Change: C581R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091551
Gene: ENSMUSG00000017631
AA Change: C581R

DomainStartEndE-ValueType
RhoGEF 107 295 2.37e-56 SMART
PH 314 473 1.58e-11 SMART
C2 517 624 1.88e-11 SMART
RhoGAP 670 849 6.57e-67 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108407
AA Change: C523R

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104044
Gene: ENSMUSG00000017631
AA Change: C523R

DomainStartEndE-ValueType
RhoGEF 49 237 2.37e-56 SMART
PH 256 415 1.58e-11 SMART
C2 459 566 1.88e-11 SMART
RhoGAP 612 791 6.57e-67 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108408
AA Change: C532R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104045
Gene: ENSMUSG00000017631
AA Change: C532R

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
RhoGEF 58 246 2.37e-56 SMART
PH 265 424 1.58e-11 SMART
C2 468 575 1.88e-11 SMART
RhoGAP 621 800 6.57e-67 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130364
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to the protein encoded by the breakpoint cluster region gene located on chromosome 22. The protein encoded by this gene contains a GTPase-activating protein domain, a domain found in members of the Rho family of GTP-binding proteins. Functional studies in mice determined that this protein plays a role in vestibular morphogenesis. Alternatively spliced transcript variants have been reported for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mutants are apparently normal, but double knockouts with Bcr show increased postnatal mortality, ataxia, hyperactivity, circling, lack of vestibular otoconia, ectopic cerebellar granule cells, and foliation defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Edem2 A C 2: 155,710,973 probably null Het
Hhatl A G 9: 121,788,171 V332A possibly damaging Het
Igsf9b G A 9: 27,309,478 V47I possibly damaging Het
Irf2bp1 G T 7: 19,005,799 A455S probably benign Het
Lyg2 G A 1: 37,915,735 L10F probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mindy4 G A 6: 55,300,949 V593I probably damaging Het
Nectin3 A T 16: 46,454,736 D319E probably benign Het
Olfr589 C A 7: 103,154,950 G266C probably damaging Het
Olfr6 T A 7: 106,956,373 M188L probably benign Het
Plcb4 G A 2: 135,971,861 probably null Het
Prkd3 T C 17: 78,968,078 T446A probably benign Het
Scn11a T A 9: 119,758,602 T1359S probably benign Het
Skp1a T C 11: 52,243,619 I59T possibly damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spta1 A G 1: 174,244,114 E2220G probably damaging Het
Strn4 A G 7: 16,826,466 Y181C probably damaging Het
Vmn1r119 A T 7: 21,012,259 L66H probably damaging Het
Other mutations in Abr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Abr APN 11 76423089 missense probably damaging 0.96
IGL00571:Abr APN 11 76468740 missense probably benign 0.45
IGL01774:Abr APN 11 76464299 splice site probably benign
IGL02208:Abr APN 11 76455645 missense probably damaging 1.00
IGL02477:Abr APN 11 76461360 missense probably damaging 1.00
IGL02499:Abr APN 11 76509090 missense probably benign 0.39
IGL02606:Abr APN 11 76479164 missense probably damaging 1.00
IGL02955:Abr APN 11 76419165 missense probably damaging 1.00
IGL03136:Abr APN 11 76425295 nonsense probably null
R0051:Abr UTSW 11 76472502 missense probably benign 0.02
R0311:Abr UTSW 11 76509127 missense possibly damaging 0.83
R0344:Abr UTSW 11 76479044 missense probably damaging 0.99
R0621:Abr UTSW 11 76509072 missense probably damaging 1.00
R0771:Abr UTSW 11 76455683 missense probably damaging 1.00
R1081:Abr UTSW 11 76455615 missense probably damaging 1.00
R1842:Abr UTSW 11 76508986 missense probably damaging 1.00
R2036:Abr UTSW 11 76452350 missense probably benign 0.08
R2147:Abr UTSW 11 76455648 missense probably damaging 1.00
R3153:Abr UTSW 11 76486469 missense probably damaging 1.00
R3928:Abr UTSW 11 76468735 missense probably benign 0.01
R4507:Abr UTSW 11 76451857 missense possibly damaging 0.65
R4518:Abr UTSW 11 76472518 missense possibly damaging 0.72
R4632:Abr UTSW 11 76509019 missense probably benign 0.10
R4751:Abr UTSW 11 76456608 missense possibly damaging 0.79
R4853:Abr UTSW 11 76464261 missense probably damaging 1.00
R5255:Abr UTSW 11 76455683 missense probably damaging 1.00
R5693:Abr UTSW 11 76463577 missense probably damaging 1.00
R6459:Abr UTSW 11 76424989 missense probably damaging 0.98
R6478:Abr UTSW 11 76452332 missense probably damaging 0.99
R7030:Abr UTSW 11 76459212 missense probably damaging 1.00
R7221:Abr UTSW 11 76423161 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGAACTTGTCTTAGCTTTGAGCC -3'
(R):5'- TCCAGAAAGTACCAGTGCCC -3'

Sequencing Primer
(F):5'- TTTGAGCCAAAGTCAGAAAAGACC -3'
(R):5'- AGAAAGTACCAGTGCCCCTCTTTG -3'
Posted On2014-10-15