Incidental Mutation 'R0165:Trpm7'
ID24088
Institutional Source Beutler Lab
Gene Symbol Trpm7
Ensembl Gene ENSMUSG00000027365
Gene Nametransient receptor potential cation channel, subfamily M, member 7
SynonymsLTRPC7, 2310022G15Rik, CHAK, CHAK1, Ltpr7, 4833414K03Rik, 5033407O22Rik, TRP-PLIK
MMRRC Submission 038441-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0165 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location126791565-126876230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126797513 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1684 (F1684I)
Ref Sequence ENSEMBL: ENSMUSP00000099513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028843] [ENSMUST00000103224]
PDB Structure
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (AMPPNP COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (ADP-MG COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (APO) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028843
AA Change: F1683I

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028843
Gene: ENSMUSG00000027365
AA Change: F1683I

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
transmembrane domain 853 875 N/A INTRINSIC
Pfam:Ion_trans 887 1096 3e-8 PFAM
PDB:3E7K|H 1198 1249 6e-27 PDB
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1545 6e-64 BLAST
Alpha_kinase 1596 1813 3.77e-89 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103224
AA Change: F1684I

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099513
Gene: ENSMUSG00000027365
AA Change: F1684I

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
Pfam:Ion_trans 855 1108 1.7e-9 PFAM
Pfam:TRPM_tetra 1194 1249 3.3e-29 PFAM
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1546 2e-64 BLAST
Alpha_kinase 1597 1814 3.77e-89 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125327
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135733
Predicted Effect unknown
Transcript: ENSMUST00000136964
AA Change: F74I
SMART Domains Protein: ENSMUSP00000119232
Gene: ENSMUSG00000027365
AA Change: F74I

DomainStartEndE-ValueType
Alpha_kinase 1 242 8e-61 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155675
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.2%
  • 20x: 91.4%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is both an ion channel and a serine/threonine protein kinase. The kinase activity is essential for the ion channel function, which serves to increase intracellular calcium levels and to help regulate magnesium ion homeostasis. Defects in this gene are a cause of amyotrophic lateral sclerosis-parkinsonism/dementia complex of Guam. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele display embryonic lehality. Mice with conditional deletion in developing thymocytes display a block in thymopoiesis. Mice homozygous for a kinase deleted allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit altered magnesium homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,216,382 V1413M probably damaging Het
2700049A03Rik T C 12: 71,167,150 I717T possibly damaging Het
3632451O06Rik A G 14: 49,773,786 S155P probably benign Het
6430571L13Rik A G 9: 107,346,184 probably benign Het
Abca15 T A 7: 120,350,903 probably benign Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Adgrl2 A G 3: 148,852,863 probably benign Het
Agap3 A G 5: 24,479,745 T544A probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Akr1c20 T C 13: 4,523,296 T7A probably benign Het
Ankrd26 A G 6: 118,540,484 S459P probably benign Het
Ascc3 T A 10: 50,842,127 probably null Het
Brd1 T C 15: 88,729,777 N305S probably damaging Het
Catip T A 1: 74,368,469 L320Q possibly damaging Het
Cttnbp2 G A 6: 18,435,410 Q150* probably null Het
Cyp2d22 T G 15: 82,373,280 N228T probably benign Het
Dapk1 T C 13: 60,761,593 V1340A probably benign Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Ddhd1 G A 14: 45,595,592 T849M probably damaging Het
Dnah6 A G 6: 73,021,323 S3987P probably benign Het
Dst C A 1: 34,154,646 probably benign Het
Epha2 T C 4: 141,321,892 probably null Het
Ern2 T C 7: 122,179,779 T281A probably benign Het
Extl1 A G 4: 134,357,703 F652S probably damaging Het
Gckr A G 5: 31,326,948 S541G possibly damaging Het
Gdap1l1 A G 2: 163,451,499 probably null Het
Gm7535 T C 17: 17,911,175 probably benign Het
Gmps T A 3: 63,993,954 I398N probably damaging Het
Igf2r A G 17: 12,698,527 V1556A probably benign Het
Il3ra T A 14: 14,350,967 N283K probably benign Het
Ist1 A G 8: 109,675,366 probably benign Het
Lama3 A T 18: 12,524,810 I1934F probably damaging Het
Lars A T 18: 42,202,697 M1118K possibly damaging Het
Lpin2 C T 17: 71,246,519 S846L probably damaging Het
Lrrc4b C A 7: 44,462,315 T537K probably damaging Het
Ltn1 G A 16: 87,405,519 probably benign Het
Meiob A G 17: 24,835,161 T401A probably benign Het
Mettl21e G A 1: 44,211,123 T41M probably damaging Het
Miga1 C T 3: 152,290,843 E323K probably damaging Het
Ndufs1 A T 1: 63,159,748 probably null Het
Olfr486 T C 7: 108,172,675 D23G probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parp6 T C 9: 59,632,925 Y274H probably damaging Het
Prom2 A T 2: 127,539,514 probably benign Het
Prune2 T A 19: 17,122,610 M1826K probably benign Het
Qk T A 17: 10,238,963 D159V probably damaging Het
Rab12 A T 17: 66,500,317 I139N probably damaging Het
Rab25 T A 3: 88,548,055 E7D probably benign Het
Rala A T 13: 17,888,589 V139E probably benign Het
Ralgapa2 A G 2: 146,388,487 probably benign Het
Rbl2 T A 8: 91,074,176 Y89N probably damaging Het
Rho A T 6: 115,932,227 I75F probably damaging Het
Slc38a4 C A 15: 97,008,949 A303S probably benign Het
Slc6a15 A G 10: 103,409,809 D551G probably null Het
Smyd3 T C 1: 179,043,872 N314S probably benign Het
Speer4f1 T A 5: 17,479,514 L180* probably null Het
Stat6 T C 10: 127,657,227 V576A probably damaging Het
Strn T C 17: 78,677,374 D127G possibly damaging Het
Syne1 T C 10: 5,033,096 R8610G probably benign Het
Tbc1d7 A C 13: 43,153,202 probably null Het
Tcf3 C T 10: 80,412,997 R548Q probably damaging Het
Tlr9 C A 9: 106,226,087 A859D probably benign Het
Tmem106c T A 15: 97,968,139 probably benign Het
Tmprss11c A T 5: 86,231,927 probably benign Het
Tnfsf18 A G 1: 161,494,731 R7G probably benign Het
Tnrc6b T A 15: 80,858,670 probably null Het
Ttbk1 C A 17: 46,478,938 R133L possibly damaging Het
Ttn A G 2: 76,721,342 S22962P probably damaging Het
Ube2q1 T A 3: 89,776,153 L135Q probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vwce T C 19: 10,659,973 probably benign Het
Wdhd1 A G 14: 47,267,068 S350P probably benign Het
Zbtb21 A G 16: 97,951,404 S560P probably damaging Het
Other mutations in Trpm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Trpm7 APN 2 126829031 missense possibly damaging 0.82
IGL01084:Trpm7 APN 2 126846072 critical splice donor site probably null
IGL01634:Trpm7 APN 2 126826818 missense probably damaging 1.00
IGL01678:Trpm7 APN 2 126816799 missense probably damaging 0.99
IGL02005:Trpm7 APN 2 126813184 missense probably damaging 0.97
IGL02064:Trpm7 APN 2 126797943 missense probably damaging 1.00
IGL02156:Trpm7 APN 2 126799243 unclassified probably benign
IGL02172:Trpm7 APN 2 126795328 missense possibly damaging 0.94
IGL02334:Trpm7 APN 2 126807362 missense probably benign
IGL02375:Trpm7 APN 2 126825744 missense probably damaging 1.00
IGL02388:Trpm7 APN 2 126819891 missense possibly damaging 0.80
IGL02552:Trpm7 APN 2 126840779 missense probably damaging 1.00
IGL02684:Trpm7 APN 2 126846159 missense probably damaging 0.99
IGL02901:Trpm7 APN 2 126807287 critical splice donor site probably null
P0037:Trpm7 UTSW 2 126816757 splice site probably benign
R0038:Trpm7 UTSW 2 126795468 missense probably damaging 1.00
R0139:Trpm7 UTSW 2 126812771 missense probably benign
R0511:Trpm7 UTSW 2 126826718 nonsense probably null
R0543:Trpm7 UTSW 2 126848529 missense probably damaging 1.00
R0784:Trpm7 UTSW 2 126846072 critical splice donor site probably null
R0844:Trpm7 UTSW 2 126835508 missense probably damaging 1.00
R0865:Trpm7 UTSW 2 126799239 unclassified probably null
R0919:Trpm7 UTSW 2 126831238 missense probably damaging 1.00
R0972:Trpm7 UTSW 2 126805049 missense probably benign
R1109:Trpm7 UTSW 2 126797793 missense probably benign 0.01
R1118:Trpm7 UTSW 2 126822486 missense possibly damaging 0.63
R1278:Trpm7 UTSW 2 126825454 nonsense probably null
R1527:Trpm7 UTSW 2 126830162 missense probably benign 0.18
R1542:Trpm7 UTSW 2 126822599 nonsense probably null
R1882:Trpm7 UTSW 2 126812777 missense probably benign 0.00
R1951:Trpm7 UTSW 2 126831299 missense probably damaging 1.00
R2011:Trpm7 UTSW 2 126823997 nonsense probably null
R2012:Trpm7 UTSW 2 126823997 nonsense probably null
R2026:Trpm7 UTSW 2 126812738 missense probably benign 0.39
R2067:Trpm7 UTSW 2 126797727 missense probably damaging 1.00
R2926:Trpm7 UTSW 2 126858409 splice site probably benign
R3082:Trpm7 UTSW 2 126844422 missense possibly damaging 0.90
R3552:Trpm7 UTSW 2 126826710 splice site probably benign
R3607:Trpm7 UTSW 2 126796428 intron probably benign
R3739:Trpm7 UTSW 2 126851521 missense probably damaging 1.00
R3943:Trpm7 UTSW 2 126831218 missense possibly damaging 0.94
R4161:Trpm7 UTSW 2 126816831 missense probably damaging 1.00
R4176:Trpm7 UTSW 2 126829163 missense possibly damaging 0.83
R4392:Trpm7 UTSW 2 126795509 splice site probably null
R4392:Trpm7 UTSW 2 126848538 missense probably damaging 1.00
R4404:Trpm7 UTSW 2 126833715 missense probably damaging 0.97
R4574:Trpm7 UTSW 2 126797211 missense probably benign 0.01
R4714:Trpm7 UTSW 2 126840783 nonsense probably null
R4807:Trpm7 UTSW 2 126831229 missense probably benign 0.00
R4815:Trpm7 UTSW 2 126858492 missense probably damaging 1.00
R4846:Trpm7 UTSW 2 126813185 missense possibly damaging 0.63
R4972:Trpm7 UTSW 2 126824058 missense probably damaging 1.00
R5097:Trpm7 UTSW 2 126796336 critical splice donor site probably null
R5263:Trpm7 UTSW 2 126821217 missense probably benign 0.34
R5361:Trpm7 UTSW 2 126829241 missense possibly damaging 0.77
R5377:Trpm7 UTSW 2 126842855 critical splice donor site probably null
R5574:Trpm7 UTSW 2 126813030 missense probably benign
R5782:Trpm7 UTSW 2 126797714 missense probably benign 0.04
R5840:Trpm7 UTSW 2 126822611 nonsense probably null
R6044:Trpm7 UTSW 2 126814745 missense probably damaging 1.00
R6178:Trpm7 UTSW 2 126837381 missense probably damaging 1.00
R6196:Trpm7 UTSW 2 126825639 missense possibly damaging 0.66
R6457:Trpm7 UTSW 2 126807294 missense probably benign
R6530:Trpm7 UTSW 2 126812711 missense probably damaging 1.00
R6764:Trpm7 UTSW 2 126844420 missense possibly damaging 0.79
R6841:Trpm7 UTSW 2 126813021 missense probably benign 0.00
R6868:Trpm7 UTSW 2 126837414 missense probably damaging 1.00
R7250:Trpm7 UTSW 2 126826765 missense possibly damaging 0.87
X0026:Trpm7 UTSW 2 126829290 missense probably benign
Z1088:Trpm7 UTSW 2 126797281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCAGTCATGCACTCTTCTACAGC -3'
(R):5'- CACGATATCCTGAAGTCAGGGCATC -3'

Sequencing Primer
(F):5'- CTGCTGAATGGCAGTACAAC -3'
(R):5'- CTGAAGTCAGGGCATCTCTATATC -3'
Posted On2013-04-16