Incidental Mutation 'R2247:Slc4a11'
ID240884
Institutional Source Beutler Lab
Gene Symbol Slc4a11
Ensembl Gene ENSMUSG00000074796
Gene Namesolute carrier family 4, sodium bicarbonate transporter-like, member 11
Synonyms
MMRRC Submission 040247-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R2247 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location130684113-130697519 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130687801 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 328 (M328K)
Ref Sequence ENSEMBL: ENSMUSP00000096963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099362] [ENSMUST00000127397]
Predicted Effect probably benign
Transcript: ENSMUST00000099362
AA Change: M328K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000096963
Gene: ENSMUSG00000074796
AA Change: M328K

DomainStartEndE-ValueType
SCOP:d1a3aa_ 199 276 5e-5 SMART
Pfam:HCO3_cotransp 308 806 9.7e-153 PFAM
transmembrane domain 827 844 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127397
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144945
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-regulated, electrogenic sodium-coupled borate cotransporter that is essential for borate homeostasis, cell growth and cell proliferation. Mutations in this gene have been associated with a number of endothelial corneal dystrophies including recessive corneal endothelial dystrophy 2, corneal dystrophy and perceptive deafness, and Fuchs endothelial corneal dystrophy. Multiple transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele show a collapsed vestibular labyrinth, reduced brainstem auditory potentials, and altered corneal epithelium. Mice homozygous for a reporter allele show corneal endothelial dystrophy, polyuria, natriuresis, urinehypoosmolarity and impaired hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,435 E70G possibly damaging Het
5830411N06Rik G A 7: 140,249,129 G234S probably null Het
Ash1l C A 3: 89,007,367 P1768Q possibly damaging Het
Bicra C A 7: 15,989,234 E119D probably benign Het
Brd2 A G 17: 34,114,415 F421L probably damaging Het
Cspp1 A T 1: 10,066,460 Q182L possibly damaging Het
Dnah7b A G 1: 46,277,063 D3112G probably damaging Het
Dsc2 T A 18: 20,035,312 I697F probably damaging Het
Ephb1 A T 9: 101,996,811 S555T probably damaging Het
Fat4 A T 3: 38,892,049 D1697V probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Impg2 A G 16: 56,268,264 K1160R probably damaging Het
Jak2 T C 19: 29,283,636 V344A probably benign Het
Kcnab3 A G 11: 69,330,190 T168A probably damaging Het
Kctd18 A T 1: 57,967,642 H16Q possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mum1 A G 10: 80,240,425 Y483C probably damaging Het
Myh11 A G 16: 14,277,559 L113P probably damaging Het
Myh13 A T 11: 67,334,558 I250F probably damaging Het
Nin T C 12: 70,054,545 Y426C probably damaging Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Olfr613 T A 7: 103,551,890 probably null Het
Pbrm1 A G 14: 31,074,893 H897R probably damaging Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Psapl1 A G 5: 36,205,066 E334G probably benign Het
Raly A G 2: 154,864,033 H277R possibly damaging Het
Ranbp9 T C 13: 43,412,425 K462E probably damaging Het
Rptn A G 3: 93,396,829 T490A probably benign Het
Rtl1 T C 12: 109,594,979 H142R possibly damaging Het
Shisa3 G A 5: 67,611,323 V189M probably benign Het
Slc25a36 A T 9: 97,100,138 L28Q probably damaging Het
Slc38a8 A G 8: 119,485,650 M318T probably benign Het
Sp2 A C 11: 96,962,018 probably null Het
Sult2b1 A T 7: 45,735,310 I114N probably damaging Het
Synrg T C 11: 84,009,376 S803P probably damaging Het
Tenm4 T A 7: 96,906,009 D2603E probably benign Het
Tmem246 T C 4: 49,586,209 S320G probably benign Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,046,845 probably null Het
Zfp189 T A 4: 49,530,393 C499S possibly damaging Het
Zfp236 A G 18: 82,604,298 F1621S possibly damaging Het
Other mutations in Slc4a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Slc4a11 APN 2 130688138 missense probably benign 0.11
IGL01292:Slc4a11 APN 2 130690832 critical splice donor site probably null
IGL01330:Slc4a11 APN 2 130687682 missense probably benign 0.11
IGL01349:Slc4a11 APN 2 130686943 missense probably benign 0.33
IGL01474:Slc4a11 APN 2 130685544 missense probably damaging 1.00
IGL01528:Slc4a11 APN 2 130685408 unclassified probably benign
IGL01752:Slc4a11 APN 2 130688145 missense probably damaging 1.00
IGL01859:Slc4a11 APN 2 130684994 missense probably damaging 1.00
IGL01914:Slc4a11 APN 2 130687279 missense probably damaging 1.00
IGL02367:Slc4a11 APN 2 130684959 missense probably damaging 1.00
IGL02373:Slc4a11 APN 2 130684898 missense probably benign 0.07
IGL02516:Slc4a11 APN 2 130691393 missense possibly damaging 0.89
IGL02894:Slc4a11 APN 2 130687155 splice site probably null
R0029:Slc4a11 UTSW 2 130688054 missense probably damaging 1.00
R0077:Slc4a11 UTSW 2 130686301 unclassified probably benign
R0270:Slc4a11 UTSW 2 130690932 missense possibly damaging 0.89
R0502:Slc4a11 UTSW 2 130688157 missense probably damaging 1.00
R1316:Slc4a11 UTSW 2 130686151 missense probably benign 0.01
R1628:Slc4a11 UTSW 2 130687127 intron probably null
R1859:Slc4a11 UTSW 2 130688012 missense probably benign 0.00
R2235:Slc4a11 UTSW 2 130685624 missense probably benign 0.19
R2332:Slc4a11 UTSW 2 130684459 missense probably benign 0.17
R3840:Slc4a11 UTSW 2 130688054 missense probably damaging 1.00
R3890:Slc4a11 UTSW 2 130685785 missense probably damaging 0.98
R4296:Slc4a11 UTSW 2 130685007 missense probably benign 0.01
R4304:Slc4a11 UTSW 2 130688138 missense probably benign 0.11
R4749:Slc4a11 UTSW 2 130690867 missense probably damaging 1.00
R4927:Slc4a11 UTSW 2 130684946 missense probably damaging 0.99
R4939:Slc4a11 UTSW 2 130684868 missense probably damaging 1.00
R5756:Slc4a11 UTSW 2 130687863 missense probably benign 0.13
R5869:Slc4a11 UTSW 2 130684459 missense probably benign 0.04
R5905:Slc4a11 UTSW 2 130685052 missense probably damaging 1.00
R6709:Slc4a11 UTSW 2 130684696 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAAAGCAATGGTCGGTAG -3'
(R):5'- CATGATGATGCCAAGAGCCG -3'

Sequencing Primer
(F):5'- CAATGGTCGGTAGGAGGC -3'
(R):5'- GCATGAGCTCCCTCCATAC -3'
Posted On2014-10-15