Incidental Mutation 'R0165:Prom2'
ID24089
Institutional Source Beutler Lab
Gene Symbol Prom2
Ensembl Gene ENSMUSG00000027376
Gene Nameprominin 2
Synonyms
MMRRC Submission 038441-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0165 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location127526473-127541467 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 127539514 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028855] [ENSMUST00000103214]
Predicted Effect probably benign
Transcript: ENSMUST00000028855
SMART Domains Protein: ENSMUSP00000028855
Gene: ENSMUSG00000027376

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Prominin 25 808 3.6e-279 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103214
SMART Domains Protein: ENSMUSP00000099503
Gene: ENSMUSG00000027376

DomainStartEndE-ValueType
Pfam:Prominin 18 818 3e-288 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155581
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.2%
  • 20x: 91.4%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prominin family of pentaspan membrane glycoproteins. The encoded protein localizes to basal epithelial cells and may be involved in the organization of plasma membrane microdomains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutant mice exhibited signs of anemia, with decreased mean red blood cell count and decreased mean hemoglobin and hematocrit levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,216,382 V1413M probably damaging Het
2700049A03Rik T C 12: 71,167,150 I717T possibly damaging Het
3632451O06Rik A G 14: 49,773,786 S155P probably benign Het
6430571L13Rik A G 9: 107,346,184 probably benign Het
Abca15 T A 7: 120,350,903 probably benign Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Adgrl2 A G 3: 148,852,863 probably benign Het
Agap3 A G 5: 24,479,745 T544A probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Akr1c20 T C 13: 4,523,296 T7A probably benign Het
Ankrd26 A G 6: 118,540,484 S459P probably benign Het
Ascc3 T A 10: 50,842,127 probably null Het
Brd1 T C 15: 88,729,777 N305S probably damaging Het
Catip T A 1: 74,368,469 L320Q possibly damaging Het
Cttnbp2 G A 6: 18,435,410 Q150* probably null Het
Cyp2d22 T G 15: 82,373,280 N228T probably benign Het
Dapk1 T C 13: 60,761,593 V1340A probably benign Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Ddhd1 G A 14: 45,595,592 T849M probably damaging Het
Dnah6 A G 6: 73,021,323 S3987P probably benign Het
Dst C A 1: 34,154,646 probably benign Het
Epha2 T C 4: 141,321,892 probably null Het
Ern2 T C 7: 122,179,779 T281A probably benign Het
Extl1 A G 4: 134,357,703 F652S probably damaging Het
Gckr A G 5: 31,326,948 S541G possibly damaging Het
Gdap1l1 A G 2: 163,451,499 probably null Het
Gm7535 T C 17: 17,911,175 probably benign Het
Gmps T A 3: 63,993,954 I398N probably damaging Het
Igf2r A G 17: 12,698,527 V1556A probably benign Het
Il3ra T A 14: 14,350,967 N283K probably benign Het
Ist1 A G 8: 109,675,366 probably benign Het
Lama3 A T 18: 12,524,810 I1934F probably damaging Het
Lars A T 18: 42,202,697 M1118K possibly damaging Het
Lpin2 C T 17: 71,246,519 S846L probably damaging Het
Lrrc4b C A 7: 44,462,315 T537K probably damaging Het
Ltn1 G A 16: 87,405,519 probably benign Het
Meiob A G 17: 24,835,161 T401A probably benign Het
Mettl21e G A 1: 44,211,123 T41M probably damaging Het
Miga1 C T 3: 152,290,843 E323K probably damaging Het
Ndufs1 A T 1: 63,159,748 probably null Het
Olfr486 T C 7: 108,172,675 D23G probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parp6 T C 9: 59,632,925 Y274H probably damaging Het
Prune2 T A 19: 17,122,610 M1826K probably benign Het
Qk T A 17: 10,238,963 D159V probably damaging Het
Rab12 A T 17: 66,500,317 I139N probably damaging Het
Rab25 T A 3: 88,548,055 E7D probably benign Het
Rala A T 13: 17,888,589 V139E probably benign Het
Ralgapa2 A G 2: 146,388,487 probably benign Het
Rbl2 T A 8: 91,074,176 Y89N probably damaging Het
Rho A T 6: 115,932,227 I75F probably damaging Het
Slc38a4 C A 15: 97,008,949 A303S probably benign Het
Slc6a15 A G 10: 103,409,809 D551G probably null Het
Smyd3 T C 1: 179,043,872 N314S probably benign Het
Speer4f1 T A 5: 17,479,514 L180* probably null Het
Stat6 T C 10: 127,657,227 V576A probably damaging Het
Strn T C 17: 78,677,374 D127G possibly damaging Het
Syne1 T C 10: 5,033,096 R8610G probably benign Het
Tbc1d7 A C 13: 43,153,202 probably null Het
Tcf3 C T 10: 80,412,997 R548Q probably damaging Het
Tlr9 C A 9: 106,226,087 A859D probably benign Het
Tmem106c T A 15: 97,968,139 probably benign Het
Tmprss11c A T 5: 86,231,927 probably benign Het
Tnfsf18 A G 1: 161,494,731 R7G probably benign Het
Tnrc6b T A 15: 80,858,670 probably null Het
Trpm7 A T 2: 126,797,513 F1684I probably damaging Het
Ttbk1 C A 17: 46,478,938 R133L possibly damaging Het
Ttn A G 2: 76,721,342 S22962P probably damaging Het
Ube2q1 T A 3: 89,776,153 L135Q probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vwce T C 19: 10,659,973 probably benign Het
Wdhd1 A G 14: 47,267,068 S350P probably benign Het
Zbtb21 A G 16: 97,951,404 S560P probably damaging Het
Other mutations in Prom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Prom2 APN 2 127541139 missense probably benign 0.04
IGL01140:Prom2 APN 2 127531205 splice site probably benign
IGL01300:Prom2 APN 2 127535089 missense probably benign 0.44
IGL01445:Prom2 APN 2 127539513 splice site probably benign
IGL01472:Prom2 APN 2 127532882 missense probably benign 0.39
IGL01541:Prom2 APN 2 127529130 critical splice donor site probably null
IGL01991:Prom2 APN 2 127529222 missense probably damaging 1.00
IGL02421:Prom2 APN 2 127531882 critical splice acceptor site probably null
IGL02557:Prom2 APN 2 127529471 missense possibly damaging 0.85
IGL02724:Prom2 APN 2 127538657 splice site probably benign
IGL02826:Prom2 APN 2 127531116 missense probably benign 0.07
IGL02830:Prom2 APN 2 127535069 missense possibly damaging 0.88
IGL02990:Prom2 APN 2 127528814 missense probably benign 0.10
R0110:Prom2 UTSW 2 127531113 missense possibly damaging 0.53
R0133:Prom2 UTSW 2 127538338 splice site probably benign
R0220:Prom2 UTSW 2 127541107 missense probably benign 0.03
R0466:Prom2 UTSW 2 127528789 missense probably damaging 0.99
R0505:Prom2 UTSW 2 127532867 missense possibly damaging 0.82
R0605:Prom2 UTSW 2 127539995 critical splice donor site probably null
R0633:Prom2 UTSW 2 127539525 missense probably benign 0.19
R0947:Prom2 UTSW 2 127538263 missense possibly damaging 0.69
R1682:Prom2 UTSW 2 127540162 missense possibly damaging 0.90
R1806:Prom2 UTSW 2 127532882 missense probably damaging 1.00
R1859:Prom2 UTSW 2 127541097 missense probably damaging 0.97
R1864:Prom2 UTSW 2 127539787 missense probably benign 0.00
R1866:Prom2 UTSW 2 127536594 missense probably damaging 0.99
R3824:Prom2 UTSW 2 127535673 splice site probably benign
R4472:Prom2 UTSW 2 127540191 missense probably benign 0.06
R5078:Prom2 UTSW 2 127531837 missense probably benign 0.00
R5889:Prom2 UTSW 2 127529411 missense possibly damaging 0.79
R5930:Prom2 UTSW 2 127530133 nonsense probably null
R6214:Prom2 UTSW 2 127539775 critical splice donor site probably null
R6215:Prom2 UTSW 2 127539775 critical splice donor site probably null
R6914:Prom2 UTSW 2 127530375 missense possibly damaging 0.78
R7099:Prom2 UTSW 2 127539778 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATAGGGCATTTGGCAGGATTGG -3'
(R):5'- AGTGTGAAAGCTGTCCCTGAGACC -3'

Sequencing Primer
(F):5'- CATGGTCACCCATGAGCC -3'
(R):5'- GATGTCCCTGAAGTGAGTACTATCC -3'
Posted On2013-04-16