Incidental Mutation 'R2247:Tmem246'
ID240890
Institutional Source Beutler Lab
Gene Symbol Tmem246
Ensembl Gene ENSMUSG00000039611
Gene Nametransmembrane protein 246
Synonyms
MMRRC Submission 040247-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R2247 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location49584506-49597876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49586209 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 320 (S320G)
Ref Sequence ENSEMBL: ENSMUSP00000040885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042750] [ENSMUST00000150664] [ENSMUST00000151542]
Predicted Effect probably benign
Transcript: ENSMUST00000042750
AA Change: S320G

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000040885
Gene: ENSMUSG00000039611
AA Change: S320G

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 262 280 N/A INTRINSIC
transmembrane domain 287 309 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150664
SMART Domains Protein: ENSMUSP00000115100
Gene: ENSMUSG00000039611

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
transmembrane domain 20 42 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151542
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,435 E70G possibly damaging Het
5830411N06Rik G A 7: 140,249,129 G234S probably null Het
Ash1l C A 3: 89,007,367 P1768Q possibly damaging Het
Bicra C A 7: 15,989,234 E119D probably benign Het
Brd2 A G 17: 34,114,415 F421L probably damaging Het
Cspp1 A T 1: 10,066,460 Q182L possibly damaging Het
Dnah7b A G 1: 46,277,063 D3112G probably damaging Het
Dsc2 T A 18: 20,035,312 I697F probably damaging Het
Ephb1 A T 9: 101,996,811 S555T probably damaging Het
Fat4 A T 3: 38,892,049 D1697V probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Impg2 A G 16: 56,268,264 K1160R probably damaging Het
Jak2 T C 19: 29,283,636 V344A probably benign Het
Kcnab3 A G 11: 69,330,190 T168A probably damaging Het
Kctd18 A T 1: 57,967,642 H16Q possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mum1 A G 10: 80,240,425 Y483C probably damaging Het
Myh11 A G 16: 14,277,559 L113P probably damaging Het
Myh13 A T 11: 67,334,558 I250F probably damaging Het
Nin T C 12: 70,054,545 Y426C probably damaging Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Olfr613 T A 7: 103,551,890 probably null Het
Pbrm1 A G 14: 31,074,893 H897R probably damaging Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Psapl1 A G 5: 36,205,066 E334G probably benign Het
Raly A G 2: 154,864,033 H277R possibly damaging Het
Ranbp9 T C 13: 43,412,425 K462E probably damaging Het
Rptn A G 3: 93,396,829 T490A probably benign Het
Rtl1 T C 12: 109,594,979 H142R possibly damaging Het
Shisa3 G A 5: 67,611,323 V189M probably benign Het
Slc25a36 A T 9: 97,100,138 L28Q probably damaging Het
Slc38a8 A G 8: 119,485,650 M318T probably benign Het
Slc4a11 A T 2: 130,687,801 M328K probably benign Het
Sp2 A C 11: 96,962,018 probably null Het
Sult2b1 A T 7: 45,735,310 I114N probably damaging Het
Synrg T C 11: 84,009,376 S803P probably damaging Het
Tenm4 T A 7: 96,906,009 D2603E probably benign Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,046,845 probably null Het
Zfp189 T A 4: 49,530,393 C499S possibly damaging Het
Zfp236 A G 18: 82,604,298 F1621S possibly damaging Het
Other mutations in Tmem246
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Tmem246 APN 4 49586860 missense possibly damaging 0.92
IGL02210:Tmem246 APN 4 49586686 missense probably benign
IGL03239:Tmem246 APN 4 49586034 missense probably damaging 0.99
R0344:Tmem246 UTSW 4 49586566 missense probably benign
R1134:Tmem246 UTSW 4 49586832 missense probably benign
R1392:Tmem246 UTSW 4 49586919 missense probably damaging 1.00
R1392:Tmem246 UTSW 4 49586919 missense probably damaging 1.00
R2288:Tmem246 UTSW 4 49586445 missense probably damaging 1.00
R4630:Tmem246 UTSW 4 49586254 missense probably benign 0.40
R5530:Tmem246 UTSW 4 49586226 missense probably benign 0.04
R5939:Tmem246 UTSW 4 49586412 missense probably damaging 0.98
R5955:Tmem246 UTSW 4 49586613 missense probably damaging 1.00
R7009:Tmem246 UTSW 4 49586325 missense probably benign
Z1088:Tmem246 UTSW 4 49587135 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTTCACAAGGTTGGGCTCCAC -3'
(R):5'- GAGAGGCTACAGCACTACATC -3'

Sequencing Primer
(F):5'- AAGGTTGGGCTCCACCACATAG -3'
(R):5'- CCTATGCGGATCCTGGAGTG -3'
Posted On2014-10-15