Incidental Mutation 'R2247:Sult2b1'
ID240895
Institutional Source Beutler Lab
Gene Symbol Sult2b1
Ensembl Gene ENSMUSG00000003271
Gene Namesulfotransferase family, cytosolic, 2B, member 1
SynonymsSULT2B
MMRRC Submission 040247-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R2247 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45729983-45784669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45735310 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 114 (I114N)
Ref Sequence ENSEMBL: ENSMUSP00000148064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075571] [ENSMUST00000209739] [ENSMUST00000210147] [ENSMUST00000210754]
Predicted Effect probably damaging
Transcript: ENSMUST00000075571
AA Change: I80N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075005
Gene: ENSMUSG00000003271
AA Change: I80N

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 57 302 7.8e-84 PFAM
low complexity region 309 337 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107735
AA Change: I114N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103363
Gene: ENSMUSG00000003271
AA Change: I114N

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 91 336 5.2e-84 PFAM
Pfam:Sulfotransfer_3 92 262 5.1e-11 PFAM
low complexity region 343 371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209435
Predicted Effect probably damaging
Transcript: ENSMUST00000209739
AA Change: I112N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000210147
AA Change: I76N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000210754
AA Change: I114N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene sulfates dehydroepiandrosterone but not 4-nitrophenol, a typical substrate for the phenol and estrogen sulfotransferase subfamilies. Two alternatively spliced variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele lack cholesterol sulfate in the dermis but otherwise appear to have normal lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,435 E70G possibly damaging Het
5830411N06Rik G A 7: 140,249,129 G234S probably null Het
Ash1l C A 3: 89,007,367 P1768Q possibly damaging Het
Bicra C A 7: 15,989,234 E119D probably benign Het
Brd2 A G 17: 34,114,415 F421L probably damaging Het
Cspp1 A T 1: 10,066,460 Q182L possibly damaging Het
Dnah7b A G 1: 46,277,063 D3112G probably damaging Het
Dsc2 T A 18: 20,035,312 I697F probably damaging Het
Ephb1 A T 9: 101,996,811 S555T probably damaging Het
Fat4 A T 3: 38,892,049 D1697V probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Impg2 A G 16: 56,268,264 K1160R probably damaging Het
Jak2 T C 19: 29,283,636 V344A probably benign Het
Kcnab3 A G 11: 69,330,190 T168A probably damaging Het
Kctd18 A T 1: 57,967,642 H16Q possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mum1 A G 10: 80,240,425 Y483C probably damaging Het
Myh11 A G 16: 14,277,559 L113P probably damaging Het
Myh13 A T 11: 67,334,558 I250F probably damaging Het
Nin T C 12: 70,054,545 Y426C probably damaging Het
Olfr479 C T 7: 108,055,782 R267C probably benign Het
Olfr613 T A 7: 103,551,890 probably null Het
Pbrm1 A G 14: 31,074,893 H897R probably damaging Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Psapl1 A G 5: 36,205,066 E334G probably benign Het
Raly A G 2: 154,864,033 H277R possibly damaging Het
Ranbp9 T C 13: 43,412,425 K462E probably damaging Het
Rptn A G 3: 93,396,829 T490A probably benign Het
Rtl1 T C 12: 109,594,979 H142R possibly damaging Het
Shisa3 G A 5: 67,611,323 V189M probably benign Het
Slc25a36 A T 9: 97,100,138 L28Q probably damaging Het
Slc38a8 A G 8: 119,485,650 M318T probably benign Het
Slc4a11 A T 2: 130,687,801 M328K probably benign Het
Sp2 A C 11: 96,962,018 probably null Het
Synrg T C 11: 84,009,376 S803P probably damaging Het
Tenm4 T A 7: 96,906,009 D2603E probably benign Het
Tmem246 T C 4: 49,586,209 S320G probably benign Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,046,845 probably null Het
Zfp189 T A 4: 49,530,393 C499S possibly damaging Het
Zfp236 A G 18: 82,604,298 F1621S possibly damaging Het
Other mutations in Sult2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02415:Sult2b1 APN 7 45742085 missense possibly damaging 0.86
IGL02964:Sult2b1 APN 7 45735274 missense probably benign 0.01
IGL03208:Sult2b1 APN 7 45733629 missense probably damaging 1.00
R0392:Sult2b1 UTSW 7 45733638 missense probably damaging 1.00
R0415:Sult2b1 UTSW 7 45730092 unclassified probably benign
R3851:Sult2b1 UTSW 7 45730037 unclassified probably benign
R3935:Sult2b1 UTSW 7 45742216 missense probably benign 0.09
R3936:Sult2b1 UTSW 7 45742216 missense probably benign 0.09
R4179:Sult2b1 UTSW 7 45735311 missense probably damaging 1.00
R4723:Sult2b1 UTSW 7 45742065 missense probably damaging 1.00
R5634:Sult2b1 UTSW 7 45734082 missense probably damaging 0.99
R5782:Sult2b1 UTSW 7 45731346 missense probably damaging 1.00
R6562:Sult2b1 UTSW 7 45742246 missense probably benign 0.00
R6816:Sult2b1 UTSW 7 45733678 missense probably damaging 1.00
R6921:Sult2b1 UTSW 7 45735188 missense probably damaging 1.00
R7145:Sult2b1 UTSW 7 45733632 missense probably damaging 1.00
R7250:Sult2b1 UTSW 7 45783937 missense unknown
Predicted Primers PCR Primer
(F):5'- CCGCATGTCAATCAATCAGATC -3'
(R):5'- TGCTTTCCTATGGCTCCAAG -3'

Sequencing Primer
(F):5'- ACCTCACCTTAGCCTTGGAG -3'
(R):5'- GCACAGTGCTGACTTGGGAAC -3'
Posted On2014-10-15