Incidental Mutation 'R2247:Olfr479'
ID240898
Institutional Source Beutler Lab
Gene Symbol Olfr479
Ensembl Gene ENSMUSG00000043855
Gene Nameolfactory receptor 479
SynonymsMOR267-15, GA_x6K02T2PBJ9-10384085-10385068
MMRRC Submission 040247-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R2247 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108050693-108056783 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108055782 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 267 (R267C)
Ref Sequence ENSEMBL: ENSMUSP00000149060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063151] [ENSMUST00000209805] [ENSMUST00000214599]
Predicted Effect probably benign
Transcript: ENSMUST00000063151
AA Change: R267C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000056631
Gene: ENSMUSG00000043855
AA Change: R267C

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 7.5e-45 PFAM
Pfam:7tm_1 39 301 1.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209805
AA Change: R267C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000214599
AA Change: R267C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,877,435 E70G possibly damaging Het
5830411N06Rik G A 7: 140,249,129 G234S probably null Het
Ash1l C A 3: 89,007,367 P1768Q possibly damaging Het
Bicra C A 7: 15,989,234 E119D probably benign Het
Brd2 A G 17: 34,114,415 F421L probably damaging Het
Cspp1 A T 1: 10,066,460 Q182L possibly damaging Het
Dnah7b A G 1: 46,277,063 D3112G probably damaging Het
Dsc2 T A 18: 20,035,312 I697F probably damaging Het
Ephb1 A T 9: 101,996,811 S555T probably damaging Het
Fat4 A T 3: 38,892,049 D1697V probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Impg2 A G 16: 56,268,264 K1160R probably damaging Het
Jak2 T C 19: 29,283,636 V344A probably benign Het
Kcnab3 A G 11: 69,330,190 T168A probably damaging Het
Kctd18 A T 1: 57,967,642 H16Q possibly damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mum1 A G 10: 80,240,425 Y483C probably damaging Het
Myh11 A G 16: 14,277,559 L113P probably damaging Het
Myh13 A T 11: 67,334,558 I250F probably damaging Het
Nin T C 12: 70,054,545 Y426C probably damaging Het
Olfr613 T A 7: 103,551,890 probably null Het
Pbrm1 A G 14: 31,074,893 H897R probably damaging Het
Plcl2 T C 17: 50,606,845 V294A probably damaging Het
Psapl1 A G 5: 36,205,066 E334G probably benign Het
Raly A G 2: 154,864,033 H277R possibly damaging Het
Ranbp9 T C 13: 43,412,425 K462E probably damaging Het
Rptn A G 3: 93,396,829 T490A probably benign Het
Rtl1 T C 12: 109,594,979 H142R possibly damaging Het
Shisa3 G A 5: 67,611,323 V189M probably benign Het
Slc25a36 A T 9: 97,100,138 L28Q probably damaging Het
Slc38a8 A G 8: 119,485,650 M318T probably benign Het
Slc4a11 A T 2: 130,687,801 M328K probably benign Het
Sp2 A C 11: 96,962,018 probably null Het
Sult2b1 A T 7: 45,735,310 I114N probably damaging Het
Synrg T C 11: 84,009,376 S803P probably damaging Het
Tenm4 T A 7: 96,906,009 D2603E probably benign Het
Tmem246 T C 4: 49,586,209 S320G probably benign Het
Tnfaip8 ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC ACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 18: 50,046,845 probably null Het
Zfp189 T A 4: 49,530,393 C499S possibly damaging Het
Zfp236 A G 18: 82,604,298 F1621S possibly damaging Het
Other mutations in Olfr479
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Olfr479 APN 7 108055567 missense probably damaging 0.96
IGL01320:Olfr479 APN 7 108054981 utr 5 prime probably benign
IGL01322:Olfr479 APN 7 108054981 utr 5 prime probably benign
R0396:Olfr479 UTSW 7 108055963 missense probably benign 0.11
R0539:Olfr479 UTSW 7 108055822 missense probably damaging 1.00
R2129:Olfr479 UTSW 7 108055904 missense probably benign 0.25
R2246:Olfr479 UTSW 7 108055782 missense probably benign 0.00
R3149:Olfr479 UTSW 7 108055782 missense probably benign 0.00
R3709:Olfr479 UTSW 7 108055797 missense possibly damaging 0.63
R3714:Olfr479 UTSW 7 108055435 missense probably damaging 0.99
R4326:Olfr479 UTSW 7 108055155 missense probably damaging 1.00
R4962:Olfr479 UTSW 7 108055440 missense probably benign 0.27
R5053:Olfr479 UTSW 7 108055534 missense probably benign 0.10
R5976:Olfr479 UTSW 7 108055798 missense possibly damaging 0.89
R6151:Olfr479 UTSW 7 108055899 missense probably benign
R6939:Olfr479 UTSW 7 108055105 missense possibly damaging 0.87
R7271:Olfr479 UTSW 7 108055216 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCCTGTGATTACACTGC -3'
(R):5'- AATTTCCCACTATTGTTGTCAGTGC -3'

Sequencing Primer
(F):5'- GTGATTACACTGCTCATCATGC -3'
(R):5'- CCACTATTGTTGTCAGTGCTCAATAG -3'
Posted On2014-10-15