Incidental Mutation 'R0165:Ube2q1'
ID24093
Institutional Source Beutler Lab
Gene Symbol Ube2q1
Ensembl Gene ENSMUSG00000042572
Gene Nameubiquitin-conjugating enzyme E2Q family member 1
SynonymsPRO3094, 2310012M18Rik, NICE-5, 1110002C01Rik
MMRRC Submission 038441-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R0165 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location89773616-89784000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89776153 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 135 (L135Q)
Ref Sequence ENSEMBL: ENSMUSP00000037939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038356] [ENSMUST00000196726]
Predicted Effect probably damaging
Transcript: ENSMUST00000038356
AA Change: L135Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037939
Gene: ENSMUSG00000042572
AA Change: L135Q

DomainStartEndE-ValueType
low complexity region 2 39 N/A INTRINSIC
Blast:RWD 43 156 1e-42 BLAST
low complexity region 183 202 N/A INTRINSIC
Blast:UBCc 203 243 8e-13 BLAST
UBCc 254 415 2.8e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000038450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195940
Predicted Effect probably benign
Transcript: ENSMUST00000196726
SMART Domains Protein: ENSMUSP00000143422
Gene: ENSMUSG00000042572

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
Blast:UBCc 34 74 1e-13 BLAST
UBCc 85 246 2.8e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199427
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.2%
  • 20x: 91.4%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes (E1s), ubiquitin-conjugating enzymes (E2s), and ubiquitin-protein ligases (E3s). This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein is 98% identical to the mouse counterpart. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female-specific pleiotropic reproductive defects and partial embryonic lethality at implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,216,382 V1413M probably damaging Het
2700049A03Rik T C 12: 71,167,150 I717T possibly damaging Het
3632451O06Rik A G 14: 49,773,786 S155P probably benign Het
6430571L13Rik A G 9: 107,346,184 probably benign Het
Abca15 T A 7: 120,350,903 probably benign Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Adgrl2 A G 3: 148,852,863 probably benign Het
Agap3 A G 5: 24,479,745 T544A probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Akr1c20 T C 13: 4,523,296 T7A probably benign Het
Ankrd26 A G 6: 118,540,484 S459P probably benign Het
Ascc3 T A 10: 50,842,127 probably null Het
Brd1 T C 15: 88,729,777 N305S probably damaging Het
Catip T A 1: 74,368,469 L320Q possibly damaging Het
Cttnbp2 G A 6: 18,435,410 Q150* probably null Het
Cyp2d22 T G 15: 82,373,280 N228T probably benign Het
Dapk1 T C 13: 60,761,593 V1340A probably benign Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Ddhd1 G A 14: 45,595,592 T849M probably damaging Het
Dnah6 A G 6: 73,021,323 S3987P probably benign Het
Dst C A 1: 34,154,646 probably benign Het
Epha2 T C 4: 141,321,892 probably null Het
Ern2 T C 7: 122,179,779 T281A probably benign Het
Extl1 A G 4: 134,357,703 F652S probably damaging Het
Gckr A G 5: 31,326,948 S541G possibly damaging Het
Gdap1l1 A G 2: 163,451,499 probably null Het
Gm7535 T C 17: 17,911,175 probably benign Het
Gmps T A 3: 63,993,954 I398N probably damaging Het
Igf2r A G 17: 12,698,527 V1556A probably benign Het
Il3ra T A 14: 14,350,967 N283K probably benign Het
Ist1 A G 8: 109,675,366 probably benign Het
Lama3 A T 18: 12,524,810 I1934F probably damaging Het
Lars A T 18: 42,202,697 M1118K possibly damaging Het
Lpin2 C T 17: 71,246,519 S846L probably damaging Het
Lrrc4b C A 7: 44,462,315 T537K probably damaging Het
Ltn1 G A 16: 87,405,519 probably benign Het
Meiob A G 17: 24,835,161 T401A probably benign Het
Mettl21e G A 1: 44,211,123 T41M probably damaging Het
Miga1 C T 3: 152,290,843 E323K probably damaging Het
Ndufs1 A T 1: 63,159,748 probably null Het
Olfr486 T C 7: 108,172,675 D23G probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parp6 T C 9: 59,632,925 Y274H probably damaging Het
Prom2 A T 2: 127,539,514 probably benign Het
Prune2 T A 19: 17,122,610 M1826K probably benign Het
Qk T A 17: 10,238,963 D159V probably damaging Het
Rab12 A T 17: 66,500,317 I139N probably damaging Het
Rab25 T A 3: 88,548,055 E7D probably benign Het
Rala A T 13: 17,888,589 V139E probably benign Het
Ralgapa2 A G 2: 146,388,487 probably benign Het
Rbl2 T A 8: 91,074,176 Y89N probably damaging Het
Rho A T 6: 115,932,227 I75F probably damaging Het
Slc38a4 C A 15: 97,008,949 A303S probably benign Het
Slc6a15 A G 10: 103,409,809 D551G probably null Het
Smyd3 T C 1: 179,043,872 N314S probably benign Het
Speer4f1 T A 5: 17,479,514 L180* probably null Het
Stat6 T C 10: 127,657,227 V576A probably damaging Het
Strn T C 17: 78,677,374 D127G possibly damaging Het
Syne1 T C 10: 5,033,096 R8610G probably benign Het
Tbc1d7 A C 13: 43,153,202 probably null Het
Tcf3 C T 10: 80,412,997 R548Q probably damaging Het
Tlr9 C A 9: 106,226,087 A859D probably benign Het
Tmem106c T A 15: 97,968,139 probably benign Het
Tmprss11c A T 5: 86,231,927 probably benign Het
Tnfsf18 A G 1: 161,494,731 R7G probably benign Het
Tnrc6b T A 15: 80,858,670 probably null Het
Trpm7 A T 2: 126,797,513 F1684I probably damaging Het
Ttbk1 C A 17: 46,478,938 R133L possibly damaging Het
Ttn A G 2: 76,721,342 S22962P probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vwce T C 19: 10,659,973 probably benign Het
Wdhd1 A G 14: 47,267,068 S350P probably benign Het
Zbtb21 A G 16: 97,951,404 S560P probably damaging Het
Other mutations in Ube2q1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Ube2q1 APN 3 89781374 missense probably damaging 1.00
IGL02121:Ube2q1 APN 3 89780462 missense possibly damaging 0.55
R1680:Ube2q1 UTSW 3 89776176 missense probably benign 0.01
R2072:Ube2q1 UTSW 3 89779571 critical splice donor site probably null
R3548:Ube2q1 UTSW 3 89781076 missense probably damaging 1.00
R4932:Ube2q1 UTSW 3 89779483 nonsense probably null
R5472:Ube2q1 UTSW 3 89777241 missense probably benign 0.00
R5902:Ube2q1 UTSW 3 89776180 nonsense probably null
R6161:Ube2q1 UTSW 3 89781360 splice site probably null
R7303:Ube2q1 UTSW 3 89776591 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TAGCATAGGCTCTGTTCTCCCAGC -3'
(R):5'- TCTGGCTTCAGTAGGCAACTCTCC -3'

Sequencing Primer
(F):5'- GTAGAGCCAGAGCTTCCTTTACTG -3'
(R):5'- TTCAGTAGGCAACTCTCCTAAGAAG -3'
Posted On2013-04-16