Incidental Mutation 'R0165:Cttnbp2'
ID24102
Institutional Source Beutler Lab
Gene Symbol Cttnbp2
Ensembl Gene ENSMUSG00000000416
Gene Namecortactin binding protein 2
Synonyms4732477G22Rik, 3010022N24Rik, Cortbp2, ORF4, 9130022E09Rik
MMRRC Submission 038441-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R0165 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location18366478-18514843 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 18435410 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 150 (Q150*)
Ref Sequence ENSEMBL: ENSMUSP00000118432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090601] [ENSMUST00000129669] [ENSMUST00000148602]
Predicted Effect probably null
Transcript: ENSMUST00000090601
AA Change: Q150*
SMART Domains Protein: ENSMUSP00000088089
Gene: ENSMUSG00000000416
AA Change: Q150*

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:CortBP2 32 138 3.1e-34 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
ANK 699 729 5.21e1 SMART
ANK 733 762 7.02e-5 SMART
ANK 766 795 6.55e-5 SMART
ANK 799 828 4.1e-6 SMART
ANK 832 861 1.09e-1 SMART
ANK 901 931 4.43e-2 SMART
Blast:AAA 1108 1285 1e-18 BLAST
low complexity region 1609 1623 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000129669
AA Change: Q108*
SMART Domains Protein: ENSMUSP00000116878
Gene: ENSMUSG00000000416
AA Change: Q108*

DomainStartEndE-ValueType
Pfam:CortBP2 1 100 4.6e-44 PFAM
Pfam:CortBP2 92 138 3.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139557
Predicted Effect probably benign
Transcript: ENSMUST00000146775
SMART Domains Protein: ENSMUSP00000119383
Gene: ENSMUSG00000000416

DomainStartEndE-ValueType
low complexity region 71 79 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
ANK 190 220 5.21e1 SMART
ANK 224 253 7.02e-5 SMART
ANK 257 286 6.55e-5 SMART
ANK 290 319 4.1e-6 SMART
ANK 323 352 1.09e-1 SMART
ANK 392 422 4.43e-2 SMART
Blast:AAA 599 776 1e-18 BLAST
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000148602
AA Change: Q150*
SMART Domains Protein: ENSMUSP00000118432
Gene: ENSMUSG00000000416
AA Change: Q150*

DomainStartEndE-ValueType
Pfam:CortBP2 26 138 4.3e-50 PFAM
Pfam:CortBP2 134 180 1.3e-12 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202396
Meta Mutation Damage Score 0.602 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.2%
  • 20x: 91.4%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with six ankyrin repeats and several proline-rich regions. A similar gene in rat interacts with a central regulator of the actin cytoskeleton. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,216,382 V1413M probably damaging Het
2700049A03Rik T C 12: 71,167,150 I717T possibly damaging Het
3632451O06Rik A G 14: 49,773,786 S155P probably benign Het
6430571L13Rik A G 9: 107,346,184 probably benign Het
Abca15 T A 7: 120,350,903 probably benign Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Adgrl2 A G 3: 148,852,863 probably benign Het
Agap3 A G 5: 24,479,745 T544A probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Akr1c20 T C 13: 4,523,296 T7A probably benign Het
Ankrd26 A G 6: 118,540,484 S459P probably benign Het
Ascc3 T A 10: 50,842,127 probably null Het
Brd1 T C 15: 88,729,777 N305S probably damaging Het
Catip T A 1: 74,368,469 L320Q possibly damaging Het
Cyp2d22 T G 15: 82,373,280 N228T probably benign Het
Dapk1 T C 13: 60,761,593 V1340A probably benign Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Ddhd1 G A 14: 45,595,592 T849M probably damaging Het
Dnah6 A G 6: 73,021,323 S3987P probably benign Het
Dst C A 1: 34,154,646 probably benign Het
Epha2 T C 4: 141,321,892 probably null Het
Ern2 T C 7: 122,179,779 T281A probably benign Het
Extl1 A G 4: 134,357,703 F652S probably damaging Het
Gckr A G 5: 31,326,948 S541G possibly damaging Het
Gdap1l1 A G 2: 163,451,499 probably null Het
Gm7535 T C 17: 17,911,175 probably benign Het
Gmps T A 3: 63,993,954 I398N probably damaging Het
Igf2r A G 17: 12,698,527 V1556A probably benign Het
Il3ra T A 14: 14,350,967 N283K probably benign Het
Ist1 A G 8: 109,675,366 probably benign Het
Lama3 A T 18: 12,524,810 I1934F probably damaging Het
Lars A T 18: 42,202,697 M1118K possibly damaging Het
Lpin2 C T 17: 71,246,519 S846L probably damaging Het
Lrrc4b C A 7: 44,462,315 T537K probably damaging Het
Ltn1 G A 16: 87,405,519 probably benign Het
Meiob A G 17: 24,835,161 T401A probably benign Het
Mettl21e G A 1: 44,211,123 T41M probably damaging Het
Miga1 C T 3: 152,290,843 E323K probably damaging Het
Ndufs1 A T 1: 63,159,748 probably null Het
Olfr486 T C 7: 108,172,675 D23G probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parp6 T C 9: 59,632,925 Y274H probably damaging Het
Prom2 A T 2: 127,539,514 probably benign Het
Prune2 T A 19: 17,122,610 M1826K probably benign Het
Qk T A 17: 10,238,963 D159V probably damaging Het
Rab12 A T 17: 66,500,317 I139N probably damaging Het
Rab25 T A 3: 88,548,055 E7D probably benign Het
Rala A T 13: 17,888,589 V139E probably benign Het
Ralgapa2 A G 2: 146,388,487 probably benign Het
Rbl2 T A 8: 91,074,176 Y89N probably damaging Het
Rho A T 6: 115,932,227 I75F probably damaging Het
Slc38a4 C A 15: 97,008,949 A303S probably benign Het
Slc6a15 A G 10: 103,409,809 D551G probably null Het
Smyd3 T C 1: 179,043,872 N314S probably benign Het
Speer4f1 T A 5: 17,479,514 L180* probably null Het
Stat6 T C 10: 127,657,227 V576A probably damaging Het
Strn T C 17: 78,677,374 D127G possibly damaging Het
Syne1 T C 10: 5,033,096 R8610G probably benign Het
Tbc1d7 A C 13: 43,153,202 probably null Het
Tcf3 C T 10: 80,412,997 R548Q probably damaging Het
Tlr9 C A 9: 106,226,087 A859D probably benign Het
Tmem106c T A 15: 97,968,139 probably benign Het
Tmprss11c A T 5: 86,231,927 probably benign Het
Tnfsf18 A G 1: 161,494,731 R7G probably benign Het
Tnrc6b T A 15: 80,858,670 probably null Het
Trpm7 A T 2: 126,797,513 F1684I probably damaging Het
Ttbk1 C A 17: 46,478,938 R133L possibly damaging Het
Ttn A G 2: 76,721,342 S22962P probably damaging Het
Ube2q1 T A 3: 89,776,153 L135Q probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vwce T C 19: 10,659,973 probably benign Het
Wdhd1 A G 14: 47,267,068 S350P probably benign Het
Zbtb21 A G 16: 97,951,404 S560P probably damaging Het
Other mutations in Cttnbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Cttnbp2 APN 6 18381062 missense possibly damaging 0.71
IGL01014:Cttnbp2 APN 6 18423895 missense probably damaging 0.98
IGL01148:Cttnbp2 APN 6 18382818 missense probably damaging 1.00
IGL01903:Cttnbp2 APN 6 18501965 missense probably damaging 1.00
IGL01906:Cttnbp2 APN 6 18378376 nonsense probably null
IGL01994:Cttnbp2 APN 6 18420815 missense possibly damaging 0.77
IGL02212:Cttnbp2 APN 6 18382749 missense possibly damaging 0.78
IGL02696:Cttnbp2 APN 6 18434129 missense probably benign 0.01
IGL02813:Cttnbp2 APN 6 18367538 missense possibly damaging 0.94
IGL02864:Cttnbp2 APN 6 18374549 missense probably benign 0.21
IGL03309:Cttnbp2 APN 6 18381036 missense probably damaging 0.98
FR4304:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4449:Cttnbp2 UTSW 6 18367462 utr 3 prime probably benign
FR4548:Cttnbp2 UTSW 6 18367463 utr 3 prime probably benign
FR4589:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367461 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367467 utr 3 prime probably benign
R0382:Cttnbp2 UTSW 6 18435343 missense probably benign 0.39
R0464:Cttnbp2 UTSW 6 18408691 missense possibly damaging 0.81
R0550:Cttnbp2 UTSW 6 18435309 missense possibly damaging 0.89
R0571:Cttnbp2 UTSW 6 18381103 missense probably benign
R0627:Cttnbp2 UTSW 6 18367373 makesense probably null
R0788:Cttnbp2 UTSW 6 18423835 missense probably damaging 1.00
R0826:Cttnbp2 UTSW 6 18405178 splice site probably benign
R1319:Cttnbp2 UTSW 6 18434630 missense probably benign 0.00
R1476:Cttnbp2 UTSW 6 18434221 missense probably damaging 1.00
R1572:Cttnbp2 UTSW 6 18375975 missense possibly damaging 0.68
R1596:Cttnbp2 UTSW 6 18408592 missense probably damaging 1.00
R1607:Cttnbp2 UTSW 6 18435433 missense probably damaging 1.00
R1633:Cttnbp2 UTSW 6 18435167 missense probably damaging 1.00
R1634:Cttnbp2 UTSW 6 18408657 missense probably benign 0.39
R1661:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1665:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1834:Cttnbp2 UTSW 6 18501966 missense probably damaging 1.00
R1853:Cttnbp2 UTSW 6 18408602 missense probably benign 0.00
R1855:Cttnbp2 UTSW 6 18378413 missense probably benign
R2018:Cttnbp2 UTSW 6 18434518 missense probably damaging 1.00
R2169:Cttnbp2 UTSW 6 18426097 missense probably benign 0.00
R2175:Cttnbp2 UTSW 6 18434829 unclassified probably null
R2202:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2203:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2204:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2205:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2371:Cttnbp2 UTSW 6 18380604 missense possibly damaging 0.69
R2416:Cttnbp2 UTSW 6 18448286 missense probably damaging 0.99
R3414:Cttnbp2 UTSW 6 18389205 missense probably benign
R3617:Cttnbp2 UTSW 6 18414190 missense probably damaging 1.00
R3861:Cttnbp2 UTSW 6 18423833 missense probably benign 0.11
R3862:Cttnbp2 UTSW 6 18434906 missense probably benign 0.02
R3940:Cttnbp2 UTSW 6 18420975 missense probably benign 0.34
R3941:Cttnbp2 UTSW 6 18427453 missense probably benign 0.11
R4097:Cttnbp2 UTSW 6 18420872 missense probably benign
R4211:Cttnbp2 UTSW 6 18427543 missense probably damaging 1.00
R4353:Cttnbp2 UTSW 6 18514704 missense probably benign 0.00
R4367:Cttnbp2 UTSW 6 18405249 missense probably damaging 1.00
R4651:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4652:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4660:Cttnbp2 UTSW 6 18406537 missense probably benign 0.05
R4975:Cttnbp2 UTSW 6 18406526 missense possibly damaging 0.91
R5064:Cttnbp2 UTSW 6 18448279 missense probably damaging 1.00
R5205:Cttnbp2 UTSW 6 18427433 splice site probably benign
R5305:Cttnbp2 UTSW 6 18381098 missense probably benign
R5484:Cttnbp2 UTSW 6 18427690 intron probably benign
R5629:Cttnbp2 UTSW 6 18405218 missense probably damaging 1.00
R5763:Cttnbp2 UTSW 6 18414299 missense probably benign 0.00
R5766:Cttnbp2 UTSW 6 18381033 missense possibly damaging 0.87
R5942:Cttnbp2 UTSW 6 18448440 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18434233 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18448369 missense probably benign 0.01
R6163:Cttnbp2 UTSW 6 18434951 missense possibly damaging 0.91
R6545:Cttnbp2 UTSW 6 18405279 intron probably null
R6858:Cttnbp2 UTSW 6 18448453 missense probably damaging 1.00
R7037:Cttnbp2 UTSW 6 18435118 missense probably damaging 1.00
R7135:Cttnbp2 UTSW 6 18448447 missense possibly damaging 0.95
R7141:Cttnbp2 UTSW 6 18380468 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGCTGTTTCTCCAACTGAGCTTCC -3'
(R):5'- CAAACTGTGGCACTTTCGCTAACCC -3'

Sequencing Primer
(F):5'- AGCTGAGAGCTGCTCTTCTAAC -3'
(R):5'- CCCAAATCATGCCATTGTTCAG -3'
Posted On2013-04-16