Incidental Mutation 'R0165:Olfr486'
ID24106
Institutional Source Beutler Lab
Gene Symbol Olfr486
Ensembl Gene ENSMUSG00000096068
Gene Nameolfactory receptor 486
SynonymsMOR204-19, GA_x6K02T2PBJ9-10501920-10500976
MMRRC Submission 038441-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R0165 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location108171798-108172742 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108172675 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 23 (D23G)
Ref Sequence ENSEMBL: ENSMUSP00000071918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072035]
Predicted Effect probably benign
Transcript: ENSMUST00000072035
AA Change: D23G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000071918
Gene: ENSMUSG00000096068
AA Change: D23G

DomainStartEndE-ValueType
Pfam:7tm_4 31 311 6.8e-51 PFAM
Pfam:7tm_1 44 293 6.6e-24 PFAM
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.2%
  • 20x: 91.4%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,216,382 V1413M probably damaging Het
2700049A03Rik T C 12: 71,167,150 I717T possibly damaging Het
3632451O06Rik A G 14: 49,773,786 S155P probably benign Het
6430571L13Rik A G 9: 107,346,184 probably benign Het
Abca15 T A 7: 120,350,903 probably benign Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Adgrl2 A G 3: 148,852,863 probably benign Het
Agap3 A G 5: 24,479,745 T544A probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Akr1c20 T C 13: 4,523,296 T7A probably benign Het
Ankrd26 A G 6: 118,540,484 S459P probably benign Het
Ascc3 T A 10: 50,842,127 probably null Het
Brd1 T C 15: 88,729,777 N305S probably damaging Het
Catip T A 1: 74,368,469 L320Q possibly damaging Het
Cttnbp2 G A 6: 18,435,410 Q150* probably null Het
Cyp2d22 T G 15: 82,373,280 N228T probably benign Het
Dapk1 T C 13: 60,761,593 V1340A probably benign Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Ddhd1 G A 14: 45,595,592 T849M probably damaging Het
Dnah6 A G 6: 73,021,323 S3987P probably benign Het
Dst C A 1: 34,154,646 probably benign Het
Epha2 T C 4: 141,321,892 probably null Het
Ern2 T C 7: 122,179,779 T281A probably benign Het
Extl1 A G 4: 134,357,703 F652S probably damaging Het
Gckr A G 5: 31,326,948 S541G possibly damaging Het
Gdap1l1 A G 2: 163,451,499 probably null Het
Gm7535 T C 17: 17,911,175 probably benign Het
Gmps T A 3: 63,993,954 I398N probably damaging Het
Igf2r A G 17: 12,698,527 V1556A probably benign Het
Il3ra T A 14: 14,350,967 N283K probably benign Het
Ist1 A G 8: 109,675,366 probably benign Het
Lama3 A T 18: 12,524,810 I1934F probably damaging Het
Lars A T 18: 42,202,697 M1118K possibly damaging Het
Lpin2 C T 17: 71,246,519 S846L probably damaging Het
Lrrc4b C A 7: 44,462,315 T537K probably damaging Het
Ltn1 G A 16: 87,405,519 probably benign Het
Meiob A G 17: 24,835,161 T401A probably benign Het
Mettl21e G A 1: 44,211,123 T41M probably damaging Het
Miga1 C T 3: 152,290,843 E323K probably damaging Het
Ndufs1 A T 1: 63,159,748 probably null Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parp6 T C 9: 59,632,925 Y274H probably damaging Het
Prom2 A T 2: 127,539,514 probably benign Het
Prune2 T A 19: 17,122,610 M1826K probably benign Het
Qk T A 17: 10,238,963 D159V probably damaging Het
Rab12 A T 17: 66,500,317 I139N probably damaging Het
Rab25 T A 3: 88,548,055 E7D probably benign Het
Rala A T 13: 17,888,589 V139E probably benign Het
Ralgapa2 A G 2: 146,388,487 probably benign Het
Rbl2 T A 8: 91,074,176 Y89N probably damaging Het
Rho A T 6: 115,932,227 I75F probably damaging Het
Slc38a4 C A 15: 97,008,949 A303S probably benign Het
Slc6a15 A G 10: 103,409,809 D551G probably null Het
Smyd3 T C 1: 179,043,872 N314S probably benign Het
Speer4f1 T A 5: 17,479,514 L180* probably null Het
Stat6 T C 10: 127,657,227 V576A probably damaging Het
Strn T C 17: 78,677,374 D127G possibly damaging Het
Syne1 T C 10: 5,033,096 R8610G probably benign Het
Tbc1d7 A C 13: 43,153,202 probably null Het
Tcf3 C T 10: 80,412,997 R548Q probably damaging Het
Tlr9 C A 9: 106,226,087 A859D probably benign Het
Tmem106c T A 15: 97,968,139 probably benign Het
Tmprss11c A T 5: 86,231,927 probably benign Het
Tnfsf18 A G 1: 161,494,731 R7G probably benign Het
Tnrc6b T A 15: 80,858,670 probably null Het
Trpm7 A T 2: 126,797,513 F1684I probably damaging Het
Ttbk1 C A 17: 46,478,938 R133L possibly damaging Het
Ttn A G 2: 76,721,342 S22962P probably damaging Het
Ube2q1 T A 3: 89,776,153 L135Q probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vwce T C 19: 10,659,973 probably benign Het
Wdhd1 A G 14: 47,267,068 S350P probably benign Het
Zbtb21 A G 16: 97,951,404 S560P probably damaging Het
Other mutations in Olfr486
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0033:Olfr486 UTSW 7 108171927 missense probably benign 0.09
R0144:Olfr486 UTSW 7 108171971 missense probably benign 0.00
R0739:Olfr486 UTSW 7 108172010 missense probably benign 0.00
R1027:Olfr486 UTSW 7 108172141 missense probably damaging 0.98
R1781:Olfr486 UTSW 7 108171883 missense probably benign 0.06
R3729:Olfr486 UTSW 7 108172309 missense probably benign 0.13
R4505:Olfr486 UTSW 7 108171968 missense probably benign 0.00
R5223:Olfr486 UTSW 7 108172708 missense probably benign 0.20
R7089:Olfr486 UTSW 7 108172494 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCCCATATCAACAGAAGCCAAGTG -3'
(R):5'- gccaacccatcttaccCGAACATAG -3'

Sequencing Primer
(F):5'- CAGAAGCCAAGTGGCTGAG -3'
(R):5'- taCCACATTTCTAGCTTTTCTGATTG -3'
Posted On2013-04-16