Incidental Mutation 'R2215:Sppl2a'
ID241065
Institutional Source Beutler Lab
Gene Symbol Sppl2a
Ensembl Gene ENSMUSG00000027366
Gene Namesignal peptide peptidase like 2A
SynonymsC130089K23Rik, 2010106G01Rik
MMRRC Submission 040217-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R2215 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location126890391-126933235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 126927834 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 34 (T34K)
Ref Sequence ENSEMBL: ENSMUSP00000028844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028844]
Predicted Effect probably benign
Transcript: ENSMUST00000028844
AA Change: T34K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000028844
Gene: ENSMUSG00000027366
AA Change: T34K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:PA 58 153 1.7e-12 PFAM
transmembrane domain 173 195 N/A INTRINSIC
PSN 218 486 3.65e-102 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125592
Meta Mutation Damage Score 0.1624 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GXGD family of aspartic proteases, which are transmembrane proteins with two conserved catalytic motifs localized within the membrane-spanning regions, as well as a member of the signal peptide peptidase-like protease (SPPL) family. This protein is expressed in all major adult human tissues and localizes to late endosomal compartments and lysosomal membranes. A pseudogene of this gene also lies on chromosome 15. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased immunoglobulin prior to and after immunization and decreased splenic B cells, myeloid dendritic cells, T2 B cells and follicular B cells. Mice homozygous for a hypomorphic allele exhibit similar albeit less severe phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,363,793 S1899T probably damaging Het
Accs G T 2: 93,841,898 N208K probably benign Het
Actn4 C A 7: 28,918,753 V22L possibly damaging Het
Adam21 A G 12: 81,560,290 S233P probably damaging Het
Agmat C T 4: 141,749,588 R102C probably benign Het
Akap8l T C 17: 32,321,595 E608G possibly damaging Het
Arap2 T C 5: 62,677,176 I788V probably damaging Het
Arhgef12 G T 9: 43,005,871 H391N probably damaging Het
Arhgef28 G T 13: 98,051,021 H255Q possibly damaging Het
Baz1a G A 12: 54,975,369 R43* probably null Het
Bcas3 T C 11: 85,801,943 S862P probably damaging Het
Blm A T 7: 80,499,847 H671Q possibly damaging Het
Bmp8a C T 4: 123,325,118 V166I probably benign Het
Cep120 G T 18: 53,727,635 P241Q probably damaging Het
Col14a1 G A 15: 55,380,842 G437E unknown Het
Cyp2a5 T C 7: 26,840,475 L316S probably damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Dach1 A G 14: 98,168,481 probably null Het
Ddx20 A T 3: 105,680,340 probably benign Het
Eif4enif1 A G 11: 3,227,476 S185G probably damaging Het
Ep400 A T 5: 110,693,555 L1732M probably benign Het
Fam117b T A 1: 59,969,060 I351K probably damaging Het
Fbxo31 T C 8: 121,566,311 I112V probably benign Het
Galntl5 A T 5: 25,198,478 N182I probably damaging Het
Gja8 A T 3: 96,919,902 F148Y probably damaging Het
Gm9774 G A 3: 92,428,423 A324V probably damaging Het
Gpatch1 A T 7: 35,293,827 L531Q possibly damaging Het
Gprin1 G A 13: 54,740,233 T76M probably damaging Het
Htr4 T A 18: 62,413,716 C113* probably null Het
Igf1r T A 7: 68,165,234 D294E probably benign Het
Kdm6b G A 11: 69,405,044 P799L unknown Het
Lat A T 7: 126,367,965 V139E probably damaging Het
Lrrc34 G A 3: 30,643,529 R51C probably benign Het
Map3k1 A G 13: 111,755,788 S978P probably benign Het
Masp1 T A 16: 23,452,521 D659V possibly damaging Het
Mcam A T 9: 44,139,953 R415* probably null Het
Mtmr10 A G 7: 64,337,655 T648A probably benign Het
Myh2 T C 11: 67,191,737 W1378R probably benign Het
Nipsnap2 A G 5: 129,739,585 E64G probably damaging Het
Olfr1240 T C 2: 89,440,037 M81V probably benign Het
Olfr1412 G A 1: 92,588,986 V219I probably benign Het
Olfr503 T C 7: 108,544,888 L121P probably damaging Het
Olfr788 A T 10: 129,473,420 I243F probably damaging Het
Pcdhb8 T G 18: 37,357,074 S602A probably damaging Het
Peg10 A T 6: 4,756,918 Q498L probably benign Het
Pld1 A T 3: 28,078,393 I577F probably benign Het
Plekhm1 A T 11: 103,376,985 I720N probably damaging Het
Ppp2r1a A G 17: 20,961,743 probably null Het
Retreg3 G T 11: 101,119,633 Y49* probably null Het
Rrp36 T C 17: 46,672,820 E22G possibly damaging Het
Sec14l2 C A 11: 4,109,169 A167S probably damaging Het
Sema5b A G 16: 35,660,215 T751A probably damaging Het
Smarcc1 C A 9: 110,237,839 Q1081K probably benign Het
Smox T C 2: 131,520,270 probably null Het
Spats2l A T 1: 57,946,416 T543S possibly damaging Het
Svep1 T C 4: 58,138,602 probably benign Het
Tet2 T A 3: 133,486,601 I691F probably benign Het
Tnxb T C 17: 34,704,140 Y2566H possibly damaging Het
Ttn T C 2: 76,740,509 E26680G probably damaging Het
Txlna T C 4: 129,639,318 E139G possibly damaging Het
Ubap2 T C 4: 41,196,483 T895A probably null Het
Ubr3 A T 2: 69,979,317 probably null Het
Usp37 A C 1: 74,444,526 F844V probably damaging Het
Usp6nl A G 2: 6,424,339 D204G probably damaging Het
Vmn1r230 T C 17: 20,847,422 I291T probably benign Het
Zfp229 T G 17: 21,746,277 V496G possibly damaging Het
Other mutations in Sppl2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Sppl2a APN 2 126919720 missense probably benign 0.04
IGL01471:Sppl2a APN 2 126917867 nonsense probably null
IGL01572:Sppl2a APN 2 126920312 unclassified probably null
IGL01712:Sppl2a APN 2 126904903 unclassified probably benign
IGL02203:Sppl2a APN 2 126904941 missense possibly damaging 0.68
IGL02572:Sppl2a APN 2 126926296 missense probably benign 0.07
abra UTSW 2 126923594 missense probably benign 0.00
abra2 UTSW 2 126920313 splice donor site probably null
R0023:Sppl2a UTSW 2 126913293 splice site probably null
R0240:Sppl2a UTSW 2 126920336 missense probably benign 0.14
R0240:Sppl2a UTSW 2 126920336 missense probably benign 0.14
R0458:Sppl2a UTSW 2 126904959 missense probably damaging 1.00
R0627:Sppl2a UTSW 2 126920417 splice site probably benign
R0799:Sppl2a UTSW 2 126920307 splice site probably benign
R1029:Sppl2a UTSW 2 126923594 missense probably benign 0.00
R1245:Sppl2a UTSW 2 126913521 splice site probably benign
R1669:Sppl2a UTSW 2 126917794 splice site probably benign
R2047:Sppl2a UTSW 2 126926852 missense probably damaging 1.00
R2428:Sppl2a UTSW 2 126912695 missense possibly damaging 0.93
R3522:Sppl2a UTSW 2 126920322 missense possibly damaging 0.66
R4653:Sppl2a UTSW 2 126920313 splice site probably null
R5398:Sppl2a UTSW 2 126919718 missense probably benign 0.00
R6382:Sppl2a UTSW 2 126917029 intron probably null
R6888:Sppl2a UTSW 2 126904992 missense probably damaging 0.99
R6892:Sppl2a UTSW 2 126913575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAATTCCCCAAGTCATTCCTTTCA -3'
(R):5'- GGACCCATTTTCCCCAAAGAATG -3'

Sequencing Primer
(F):5'- AGTCATTCCTTTCATCTCTTTTACAG -3'
(R):5'- TCCCCAAAGAATGAGTTTAGACAAG -3'
Posted On2014-10-15