Incidental Mutation 'R2215:Olfr503'
ID241092
Institutional Source Beutler Lab
Gene Symbol Olfr503
Ensembl Gene ENSMUSG00000060759
Gene Nameolfactory receptor 503
SynonymsGA_x6K02T2PBJ9-10874315-10875286, Olfr1548, MOR34-8P, MOR34-9, MOR34-9, MOR34-12
MMRRC Submission 040217-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R2215 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108544527-108545498 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108544888 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 119 (L119P)
Ref Sequence ENSEMBL: ENSMUSP00000147778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078162] [ENSMUST00000211693]
Predicted Effect probably damaging
Transcript: ENSMUST00000078162
AA Change: L121P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077296
Gene: ENSMUSG00000060759
AA Change: L121P

DomainStartEndE-ValueType
Pfam:7tm_4 35 315 3e-103 PFAM
Pfam:7TM_GPCR_Srsx 39 268 2.4e-7 PFAM
Pfam:7tm_1 45 297 9.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211693
AA Change: L119P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.372 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,363,793 S1899T probably damaging Het
Accs G T 2: 93,841,898 N208K probably benign Het
Actn4 C A 7: 28,918,753 V22L possibly damaging Het
Adam21 A G 12: 81,560,290 S233P probably damaging Het
Agmat C T 4: 141,749,588 R102C probably benign Het
Akap8l T C 17: 32,321,595 E608G possibly damaging Het
Arap2 T C 5: 62,677,176 I788V probably damaging Het
Arhgef12 G T 9: 43,005,871 H391N probably damaging Het
Arhgef28 G T 13: 98,051,021 H255Q possibly damaging Het
Baz1a G A 12: 54,975,369 R43* probably null Het
Bcas3 T C 11: 85,801,943 S862P probably damaging Het
Blm A T 7: 80,499,847 H671Q possibly damaging Het
Bmp8a C T 4: 123,325,118 V166I probably benign Het
Cep120 G T 18: 53,727,635 P241Q probably damaging Het
Col14a1 G A 15: 55,380,842 G437E unknown Het
Cyp2a5 T C 7: 26,840,475 L3S probably damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Dach1 A G 14: 98,168,481 probably null Het
Ddx20 A T 3: 105,680,340 probably benign Het
Eif4enif1 A G 11: 3,227,476 S185G probably damaging Het
Ep400 A T 5: 110,693,555 probably benign Het
Fam117b T A 1: 59,969,060 I351K probably damaging Het
Fbxo31 T C 8: 121,566,311 I112V probably benign Het
Galntl5 A T 5: 25,198,478 N149I probably damaging Het
Gja8 A T 3: 96,919,902 F148Y probably damaging Het
Gm9774 G A 3: 92,428,423 A324V probably damaging Het
Gpatch1 A T 7: 35,293,827 L531Q possibly damaging Het
Gprin1 G A 13: 54,740,233 T76M probably damaging Het
Htr4 T A 18: 62,413,716 C113* probably null Het
Igf1r T A 7: 68,165,234 D294E probably benign Het
Kdm6b G A 11: 69,405,044 P799L unknown Het
Lat A T 7: 126,367,965 V139E probably damaging Het
Lrrc34 G A 3: 30,643,529 R51C probably benign Het
Map3k1 A G 13: 111,755,788 S978P probably benign Het
Masp1 T A 16: 23,452,521 D659V possibly damaging Het
Mcam A T 9: 44,139,953 R415* probably null Het
Mtmr10 A G 7: 64,337,655 T648A probably benign Het
Myh2 T C 11: 67,191,737 W1378R probably benign Het
Nipsnap2 A G 5: 129,739,585 E64G probably damaging Het
Olfr1240 T C 2: 89,440,037 M81V probably benign Het
Olfr1412 G A 1: 92,588,986 V219I probably benign Het
Olfr788 A T 10: 129,473,420 I243F probably damaging Het
Pcdhb8 T G 18: 37,357,074 S602A probably damaging Het
Peg10 A T 6: 4,756,918 probably benign Het
Pld1 A T 3: 28,078,393 I577F probably benign Het
Plekhm1 A T 11: 103,376,985 I720N probably damaging Het
Ppp2r1a A G 17: 20,961,743 probably null Het
Retreg3 G T 11: 101,119,633 Y49* probably null Het
Rrp36 T C 17: 46,672,820 E22G possibly damaging Het
Sec14l2 C A 11: 4,109,169 A167S probably damaging Het
Sema5b A G 16: 35,660,215 T751A probably damaging Het
Smarcc1 C A 9: 110,237,839 probably benign Het
Smox T C 2: 131,520,270 probably null Het
Spats2l A T 1: 57,946,416 T543S possibly damaging Het
Sppl2a G T 2: 126,927,834 T34K probably benign Het
Svep1 T C 4: 58,138,602 probably benign Het
Tet2 T A 3: 133,486,601 I691F probably benign Het
Tnxb T C 17: 34,704,140 Y2566H possibly damaging Het
Ttn T C 2: 76,740,509 E26680G probably damaging Het
Txlna T C 4: 129,639,318 E139G possibly damaging Het
Ubap2 T C 4: 41,196,483 probably null Het
Ubr3 A T 2: 69,979,317 probably null Het
Usp37 A C 1: 74,444,526 F844V probably damaging Het
Usp6nl A G 2: 6,424,339 D204G probably damaging Het
Vmn1r230 T C 17: 20,847,422 I291T probably benign Het
Zfp229 T G 17: 21,746,277 V496G possibly damaging Het
Other mutations in Olfr503
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Olfr503 APN 7 108544726 nonsense probably null
IGL02031:Olfr503 APN 7 108544930 missense probably benign 0.03
IGL02426:Olfr503 APN 7 108544980 missense probably benign 0.01
IGL02502:Olfr503 APN 7 108544639 missense probably damaging 1.00
IGL03208:Olfr503 APN 7 108545119 missense probably benign 0.02
R0507:Olfr503 UTSW 7 108545085 missense probably damaging 0.98
R0967:Olfr503 UTSW 7 108544789 missense probably damaging 1.00
R1181:Olfr503 UTSW 7 108545302 missense probably benign 0.00
R1501:Olfr503 UTSW 7 108544575 missense probably benign
R1596:Olfr503 UTSW 7 108545083 missense possibly damaging 0.90
R1657:Olfr503 UTSW 7 108545377 missense possibly damaging 0.50
R1708:Olfr503 UTSW 7 108544574 missense probably benign 0.04
R4131:Olfr503 UTSW 7 108544537 nonsense probably null
R4772:Olfr503 UTSW 7 108544885 missense probably damaging 0.98
R5009:Olfr503 UTSW 7 108544848 missense probably benign 0.01
R5297:Olfr503 UTSW 7 108545404 missense probably damaging 1.00
R5788:Olfr503 UTSW 7 108545344 missense probably damaging 0.97
R5944:Olfr503 UTSW 7 108545277 missense possibly damaging 0.90
R6522:Olfr503 UTSW 7 108544995 missense probably benign 0.09
R7045:Olfr503 UTSW 7 108545245 missense probably damaging 1.00
R7339:Olfr503 UTSW 7 108544900 missense probably damaging 1.00
R7558:Olfr503 UTSW 7 108544721 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAGGATTCCTTACACAGACCCATG -3'
(R):5'- ACTTGGCTACAGACATGTGG -3'

Sequencing Primer
(F):5'- ACAGACCCATGTACTACTTTTTAGC -3'
(R):5'- TGGCTACAGACATGTGGTCACAG -3'
Posted On2014-10-15