Incidental Mutation 'R2215:Fbxo31'
ID241095
Institutional Source Beutler Lab
Gene Symbol Fbxo31
Ensembl Gene ENSMUSG00000052934
Gene NameF-box protein 31
Synonyms1110003O08Rik, Fbx14, Fbxo14, 2310046N15Rik
MMRRC Submission 040217-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R2215 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location121549440-121578806 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121566311 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 112 (I112V)
Ref Sequence ENSEMBL: ENSMUSP00000057573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059018] [ENSMUST00000127664]
Predicted Effect probably benign
Transcript: ENSMUST00000059018
AA Change: I112V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000057573
Gene: ENSMUSG00000052934
AA Change: I112V

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 25 42 N/A INTRINSIC
FBOX 56 96 3.45e-8 SMART
low complexity region 358 379 N/A INTRINSIC
low complexity region 385 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181663
SMART Domains Protein: ENSMUSP00000137907
Gene: ENSMUSG00000052934

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 25 42 N/A INTRINSIC
FBOX 56 96 3.45e-8 SMART
transmembrane domain 156 178 N/A INTRINSIC
low complexity region 190 201 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000212985
AA Change: I109V
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the F-box family. Members are classified into three classes according to the substrate interaction domain, FBW for WD40 repeats, FBL for leucing-rich repeats, and FBXO for other domains. This protein, classified into the last category because of the lack of a recognizable substrate binding domain, has been proposed to be a component of the SCF ubiquitination complex. It is thought to bind and recruit substrate for ubiquitination and degradation. This protein may have a role in regulating the cell cycle as well as dendrite growth and neuronal migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T A 11: 84,363,793 S1899T probably damaging Het
Accs G T 2: 93,841,898 N208K probably benign Het
Actn4 C A 7: 28,918,753 V22L possibly damaging Het
Adam21 A G 12: 81,560,290 S233P probably damaging Het
Agmat C T 4: 141,749,588 R102C probably benign Het
Akap8l T C 17: 32,321,595 E608G possibly damaging Het
Arap2 T C 5: 62,677,176 I788V probably damaging Het
Arhgef12 G T 9: 43,005,871 H391N probably damaging Het
Arhgef28 G T 13: 98,051,021 H255Q possibly damaging Het
Baz1a G A 12: 54,975,369 R43* probably null Het
Bcas3 T C 11: 85,801,943 S862P probably damaging Het
Blm A T 7: 80,499,847 H671Q possibly damaging Het
Bmp8a C T 4: 123,325,118 V166I probably benign Het
Cep120 G T 18: 53,727,635 P241Q probably damaging Het
Col14a1 G A 15: 55,380,842 G437E unknown Het
Cyp2a5 T C 7: 26,840,475 L3S probably damaging Het
D16Ertd472e T C 16: 78,545,267 T242A probably benign Het
Dach1 A G 14: 98,168,481 probably null Het
Ddx20 A T 3: 105,680,340 probably benign Het
Eif4enif1 A G 11: 3,227,476 S185G probably damaging Het
Ep400 A T 5: 110,693,555 probably benign Het
Fam117b T A 1: 59,969,060 I351K probably damaging Het
Galntl5 A T 5: 25,198,478 N149I probably damaging Het
Gja8 A T 3: 96,919,902 F148Y probably damaging Het
Gm9774 G A 3: 92,428,423 A324V probably damaging Het
Gpatch1 A T 7: 35,293,827 L531Q possibly damaging Het
Gprin1 G A 13: 54,740,233 T76M probably damaging Het
Htr4 T A 18: 62,413,716 C113* probably null Het
Igf1r T A 7: 68,165,234 D294E probably benign Het
Kdm6b G A 11: 69,405,044 P799L unknown Het
Lat A T 7: 126,367,965 V139E probably damaging Het
Lrrc34 G A 3: 30,643,529 R51C probably benign Het
Map3k1 A G 13: 111,755,788 S978P probably benign Het
Masp1 T A 16: 23,452,521 D659V possibly damaging Het
Mcam A T 9: 44,139,953 R415* probably null Het
Mtmr10 A G 7: 64,337,655 T648A probably benign Het
Myh2 T C 11: 67,191,737 W1378R probably benign Het
Nipsnap2 A G 5: 129,739,585 E64G probably damaging Het
Olfr1240 T C 2: 89,440,037 M81V probably benign Het
Olfr1412 G A 1: 92,588,986 V219I probably benign Het
Olfr503 T C 7: 108,544,888 L119P probably damaging Het
Olfr788 A T 10: 129,473,420 I243F probably damaging Het
Pcdhb8 T G 18: 37,357,074 S602A probably damaging Het
Peg10 A T 6: 4,756,918 probably benign Het
Pld1 A T 3: 28,078,393 I577F probably benign Het
Plekhm1 A T 11: 103,376,985 I720N probably damaging Het
Ppp2r1a A G 17: 20,961,743 probably null Het
Retreg3 G T 11: 101,119,633 Y49* probably null Het
Rrp36 T C 17: 46,672,820 E22G possibly damaging Het
Sec14l2 C A 11: 4,109,169 A167S probably damaging Het
Sema5b A G 16: 35,660,215 T751A probably damaging Het
Smarcc1 C A 9: 110,237,839 probably benign Het
Smox T C 2: 131,520,270 probably null Het
Spats2l A T 1: 57,946,416 T543S possibly damaging Het
Sppl2a G T 2: 126,927,834 T34K probably benign Het
Svep1 T C 4: 58,138,602 probably benign Het
Tet2 T A 3: 133,486,601 I691F probably benign Het
Tnxb T C 17: 34,704,140 Y2566H possibly damaging Het
Ttn T C 2: 76,740,509 E26680G probably damaging Het
Txlna T C 4: 129,639,318 E139G possibly damaging Het
Ubap2 T C 4: 41,196,483 probably null Het
Ubr3 A T 2: 69,979,317 probably null Het
Usp37 A C 1: 74,444,526 F844V probably damaging Het
Usp6nl A G 2: 6,424,339 D204G probably damaging Het
Vmn1r230 T C 17: 20,847,422 I291T probably benign Het
Zfp229 T G 17: 21,746,277 V496G possibly damaging Het
Other mutations in Fbxo31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Fbxo31 APN 8 121554330 missense possibly damaging 0.92
IGL02155:Fbxo31 APN 8 121559075 missense probably damaging 1.00
IGL02551:Fbxo31 APN 8 121566344 missense probably damaging 0.99
IGL03092:Fbxo31 APN 8 121560018 missense probably benign
R0377:Fbxo31 UTSW 8 121559102 unclassified probably benign
R0730:Fbxo31 UTSW 8 121555364 unclassified probably benign
R1132:Fbxo31 UTSW 8 121552276 frame shift probably null
R1132:Fbxo31 UTSW 8 121552280 frame shift probably null
R1626:Fbxo31 UTSW 8 121560006 missense probably damaging 1.00
R1796:Fbxo31 UTSW 8 121560438 nonsense probably null
R3726:Fbxo31 UTSW 8 121578509 missense probably damaging 1.00
R3761:Fbxo31 UTSW 8 121560430 missense possibly damaging 0.94
R4646:Fbxo31 UTSW 8 121560016 missense probably benign
R4782:Fbxo31 UTSW 8 121552439 nonsense probably null
R4782:Fbxo31 UTSW 8 121552441 missense probably damaging 1.00
R5103:Fbxo31 UTSW 8 121552362 missense probably damaging 1.00
R5715:Fbxo31 UTSW 8 121578563 missense probably damaging 1.00
R6347:Fbxo31 UTSW 8 121578459 missense possibly damaging 0.69
R6551:Fbxo31 UTSW 8 121564704 intron probably benign
Predicted Primers PCR Primer
(F):5'- TTTAACCGTCATGGACTTGAAAGG -3'
(R):5'- TGGACCATAGCAGAGCAGAC -3'

Sequencing Primer
(F):5'- CGTCATGGACTTGAAAGGACTGTATC -3'
(R):5'- CAGGGACTTTGGCTGTGAGC -3'
Posted On2014-10-15