Incidental Mutation 'R0165:Parp6'
ID24111
Institutional Source Beutler Lab
Gene Symbol Parp6
Ensembl Gene ENSMUSG00000025237
Gene Namepoly (ADP-ribose) polymerase family, member 6
Synonyms
MMRRC Submission 038441-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R0165 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location59617284-59650285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59632925 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 274 (Y274H)
Ref Sequence ENSEMBL: ENSMUSP00000129456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026267] [ENSMUST00000050483] [ENSMUST00000167091] [ENSMUST00000216351]
Predicted Effect probably benign
Transcript: ENSMUST00000026267
AA Change: Y274H

PolyPhen 2 Score 0.436 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026267
Gene: ENSMUSG00000025237
AA Change: Y274H

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
Pfam:PARP 450 580 5.6e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000050483
AA Change: Y254H

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000063065
Gene: ENSMUSG00000025237
AA Change: Y254H

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 303 315 N/A INTRINSIC
SCOP:d1a26_2 409 475 4e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167091
AA Change: Y274H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129456
Gene: ENSMUSG00000025237
AA Change: Y274H

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
SCOP:d1a26_2 429 473 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214956
Predicted Effect possibly damaging
Transcript: ENSMUST00000216351
AA Change: Y254H

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216482
Meta Mutation Damage Score 0.348 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.2%
  • 20x: 91.4%
Validation Efficiency 96% (81/84)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,216,382 V1413M probably damaging Het
2700049A03Rik T C 12: 71,167,150 I717T possibly damaging Het
3632451O06Rik A G 14: 49,773,786 S155P probably benign Het
6430571L13Rik A G 9: 107,346,184 probably benign Het
Abca15 T A 7: 120,350,903 probably benign Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Adgrl2 A G 3: 148,852,863 probably benign Het
Agap3 A G 5: 24,479,745 T544A probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Akr1c20 T C 13: 4,523,296 T7A probably benign Het
Ankrd26 A G 6: 118,540,484 S459P probably benign Het
Ascc3 T A 10: 50,842,127 probably null Het
Brd1 T C 15: 88,729,777 N305S probably damaging Het
Catip T A 1: 74,368,469 L320Q possibly damaging Het
Cttnbp2 G A 6: 18,435,410 Q150* probably null Het
Cyp2d22 T G 15: 82,373,280 N228T probably benign Het
Dapk1 T C 13: 60,761,593 V1340A probably benign Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Ddhd1 G A 14: 45,595,592 T849M probably damaging Het
Dnah6 A G 6: 73,021,323 S3987P probably benign Het
Dst C A 1: 34,154,646 probably benign Het
Epha2 T C 4: 141,321,892 probably null Het
Ern2 T C 7: 122,179,779 T281A probably benign Het
Extl1 A G 4: 134,357,703 F652S probably damaging Het
Gckr A G 5: 31,326,948 S541G possibly damaging Het
Gdap1l1 A G 2: 163,451,499 probably null Het
Gm7535 T C 17: 17,911,175 probably benign Het
Gmps T A 3: 63,993,954 I398N probably damaging Het
Igf2r A G 17: 12,698,527 V1556A probably benign Het
Il3ra T A 14: 14,350,967 N283K probably benign Het
Ist1 A G 8: 109,675,366 probably benign Het
Lama3 A T 18: 12,524,810 I1934F probably damaging Het
Lars A T 18: 42,202,697 M1118K possibly damaging Het
Lpin2 C T 17: 71,246,519 S846L probably damaging Het
Lrrc4b C A 7: 44,462,315 T537K probably damaging Het
Ltn1 G A 16: 87,405,519 probably benign Het
Meiob A G 17: 24,835,161 T401A probably benign Het
Mettl21e G A 1: 44,211,123 T41M probably damaging Het
Miga1 C T 3: 152,290,843 E323K probably damaging Het
Ndufs1 A T 1: 63,159,748 probably null Het
Olfr486 T C 7: 108,172,675 D23G probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Prom2 A T 2: 127,539,514 probably benign Het
Prune2 T A 19: 17,122,610 M1826K probably benign Het
Qk T A 17: 10,238,963 D159V probably damaging Het
Rab12 A T 17: 66,500,317 I139N probably damaging Het
Rab25 T A 3: 88,548,055 E7D probably benign Het
Rala A T 13: 17,888,589 V139E probably benign Het
Ralgapa2 A G 2: 146,388,487 probably benign Het
Rbl2 T A 8: 91,074,176 Y89N probably damaging Het
Rho A T 6: 115,932,227 I75F probably damaging Het
Slc38a4 C A 15: 97,008,949 A303S probably benign Het
Slc6a15 A G 10: 103,409,809 D551G probably null Het
Smyd3 T C 1: 179,043,872 N314S probably benign Het
Speer4f1 T A 5: 17,479,514 L180* probably null Het
Stat6 T C 10: 127,657,227 V576A probably damaging Het
Strn T C 17: 78,677,374 D127G possibly damaging Het
Syne1 T C 10: 5,033,096 R8610G probably benign Het
Tbc1d7 A C 13: 43,153,202 probably null Het
Tcf3 C T 10: 80,412,997 R548Q probably damaging Het
Tlr9 C A 9: 106,226,087 A859D probably benign Het
Tmem106c T A 15: 97,968,139 probably benign Het
Tmprss11c A T 5: 86,231,927 probably benign Het
Tnfsf18 A G 1: 161,494,731 R7G probably benign Het
Tnrc6b T A 15: 80,858,670 probably null Het
Trpm7 A T 2: 126,797,513 F1684I probably damaging Het
Ttbk1 C A 17: 46,478,938 R133L possibly damaging Het
Ttn A G 2: 76,721,342 S22962P probably damaging Het
Ube2q1 T A 3: 89,776,153 L135Q probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vwce T C 19: 10,659,973 probably benign Het
Wdhd1 A G 14: 47,267,068 S350P probably benign Het
Zbtb21 A G 16: 97,951,404 S560P probably damaging Het
Other mutations in Parp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Parp6 APN 9 59632959 missense probably damaging 1.00
IGL01366:Parp6 APN 9 59636713 missense possibly damaging 0.75
IGL01385:Parp6 APN 9 59630612 splice site probably benign
IGL02000:Parp6 APN 9 59648892 missense probably benign 0.00
IGL02001:Parp6 APN 9 59649961 missense possibly damaging 0.90
IGL02315:Parp6 APN 9 59641738 intron probably benign
IGL02719:Parp6 APN 9 59630738 missense probably benign 0.26
IGL02928:Parp6 APN 9 59641063 missense possibly damaging 0.70
IGL03169:Parp6 APN 9 59650017 nonsense probably null
IGL03398:Parp6 APN 9 59641053 missense probably damaging 0.97
R0602:Parp6 UTSW 9 59649365 splice site probably benign
R0781:Parp6 UTSW 9 59649564 missense probably damaging 0.99
R1110:Parp6 UTSW 9 59649564 missense probably damaging 0.99
R1730:Parp6 UTSW 9 59633538 nonsense probably null
R1783:Parp6 UTSW 9 59633538 nonsense probably null
R2264:Parp6 UTSW 9 59624005 missense probably damaging 1.00
R4323:Parp6 UTSW 9 59630686 missense possibly damaging 0.84
R4654:Parp6 UTSW 9 59641100 splice site probably null
R4672:Parp6 UTSW 9 59640110 missense probably damaging 1.00
R4673:Parp6 UTSW 9 59640110 missense probably damaging 1.00
R4708:Parp6 UTSW 9 59641769 missense probably damaging 0.98
R4709:Parp6 UTSW 9 59641769 missense probably damaging 0.98
R4763:Parp6 UTSW 9 59631365 missense probably damaging 1.00
R4782:Parp6 UTSW 9 59634984 splice site probably null
R4825:Parp6 UTSW 9 59624362 splice site probably null
R5563:Parp6 UTSW 9 59628673 splice site probably null
R5700:Parp6 UTSW 9 59624727 missense probably damaging 1.00
R6235:Parp6 UTSW 9 59630815 missense probably benign 0.34
R6269:Parp6 UTSW 9 59650012 missense probably benign
R6383:Parp6 UTSW 9 59623939 missense probably damaging 0.99
X0061:Parp6 UTSW 9 59630765 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GCAAGTCCCAGGAATTAAGGTGCAA -3'
(R):5'- AGTTTCCAGGATTGAGGACAGAACTCAT -3'

Sequencing Primer
(F):5'- gtgttggttctttccttctgtg -3'
(R):5'- GGACAGAACTCATCCTTTAATACAGG -3'
Posted On2013-04-16