Incidental Mutation 'R0165:Tcf3'
ID24114
Institutional Source Beutler Lab
Gene Symbol Tcf3
Ensembl Gene ENSMUSG00000020167
Gene Nametranscription factor 3
SynonymsA1, ALF2, bHLHb21, E12, E2A, E47, Pan1, Pan2, Tcfe2a
MMRRC Submission 038441-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R0165 (G1)
Quality Score176
Status Validated (trace)
Chromosome10
Chromosomal Location80409514-80433647 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80412997 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 548 (R548Q)
Ref Sequence ENSEMBL: ENSMUSP00000100983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020377] [ENSMUST00000020379] [ENSMUST00000105339] [ENSMUST00000105340] [ENSMUST00000105341] [ENSMUST00000105342] [ENSMUST00000105343] [ENSMUST00000105344] [ENSMUST00000105345] [ENSMUST00000105346]
Predicted Effect probably damaging
Transcript: ENSMUST00000020377
AA Change: R549Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020377
Gene: ENSMUSG00000020167
AA Change: R549Q

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
low complexity region 462 480 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
HLH 553 606 2.66e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020379
SMART Domains Protein: ENSMUSP00000020379
Gene: ENSMUSG00000020167

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 462 480 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
HLH 550 603 8.79e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105339
AA Change: R545Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100976
Gene: ENSMUSG00000020167
AA Change: R545Q

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 336 351 N/A INTRINSIC
low complexity region 458 476 N/A INTRINSIC
low complexity region 491 502 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
HLH 549 602 2.66e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105340
SMART Domains Protein: ENSMUSP00000100977
Gene: ENSMUSG00000020167

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 462 480 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
HLH 549 602 8.79e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105341
SMART Domains Protein: ENSMUSP00000100978
Gene: ENSMUSG00000020167

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 336 351 N/A INTRINSIC
low complexity region 458 476 N/A INTRINSIC
low complexity region 491 502 N/A INTRINSIC
HLH 546 599 8.79e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105342
AA Change: R550Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100979
Gene: ENSMUSG00000020167
AA Change: R550Q

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
low complexity region 463 481 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
HLH 554 607 2.66e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105343
SMART Domains Protein: ENSMUSP00000100980
Gene: ENSMUSG00000020167

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
low complexity region 462 480 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
HLH 550 603 8.79e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105344
SMART Domains Protein: ENSMUSP00000100981
Gene: ENSMUSG00000020167

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
low complexity region 463 481 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
HLH 551 604 8.79e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105345
SMART Domains Protein: ENSMUSP00000100982
Gene: ENSMUSG00000020167

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 461 479 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
HLH 549 602 8.79e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105346
AA Change: R548Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100983
Gene: ENSMUSG00000020167
AA Change: R548Q

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 461 479 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
HLH 552 605 2.66e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129027
Predicted Effect probably benign
Transcript: ENSMUST00000156990
SMART Domains Protein: ENSMUSP00000121172
Gene: ENSMUSG00000020167

DomainStartEndE-ValueType
low complexity region 47 65 N/A INTRINSIC
low complexity region 117 140 N/A INTRINSIC
low complexity region 234 257 N/A INTRINSIC
low complexity region 329 344 N/A INTRINSIC
low complexity region 451 469 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
HLH 539 592 8.79e-11 SMART
Meta Mutation Damage Score 0.348 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.2%
  • 20x: 91.4%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the E protein (class I) family of helix-loop-helix transcription factors. E proteins activate transcription by binding to regulatory E-box sequences on target genes as heterodimers or homodimers, and are inhibited by heterodimerization with inhibitor of DNA-binding (class IV) helix-loop-helix proteins. E proteins play a critical role in lymphopoiesis, and the encoded protein is required for B and T lymphocyte development. Deletion of this gene or diminished activity of the encoded protein may play a role in lymphoid malignancies. This gene is also involved in several chromosomal translocations that are associated with lymphoid malignancies including pre-B-cell acute lymphoblastic leukemia (t(1;19), with PBX1), childhood leukemia (t(19;19), with TFPT) and acute leukemia (t(12;19), with ZNF384). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations are devoid of mature B cells, have a partial early block in T-lymphocyte development, and show high postnatal mortality. Many survivors develop T-cell lymphomas between 3 and 10 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,216,382 V1413M probably damaging Het
2700049A03Rik T C 12: 71,167,150 I717T possibly damaging Het
3632451O06Rik A G 14: 49,773,786 S155P probably benign Het
6430571L13Rik A G 9: 107,346,184 probably benign Het
Abca15 T A 7: 120,350,903 probably benign Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Adgrl2 A G 3: 148,852,863 probably benign Het
Agap3 A G 5: 24,479,745 T544A probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Akr1c20 T C 13: 4,523,296 T7A probably benign Het
Ankrd26 A G 6: 118,540,484 S459P probably benign Het
Ascc3 T A 10: 50,842,127 probably null Het
Brd1 T C 15: 88,729,777 N305S probably damaging Het
Catip T A 1: 74,368,469 L320Q possibly damaging Het
Cttnbp2 G A 6: 18,435,410 Q150* probably null Het
Cyp2d22 T G 15: 82,373,280 N228T probably benign Het
Dapk1 T C 13: 60,761,593 V1340A probably benign Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Ddhd1 G A 14: 45,595,592 T849M probably damaging Het
Dnah6 A G 6: 73,021,323 S3987P probably benign Het
Dst C A 1: 34,154,646 probably benign Het
Epha2 T C 4: 141,321,892 probably null Het
Ern2 T C 7: 122,179,779 T281A probably benign Het
Extl1 A G 4: 134,357,703 F652S probably damaging Het
Gckr A G 5: 31,326,948 S541G possibly damaging Het
Gdap1l1 A G 2: 163,451,499 probably null Het
Gm7535 T C 17: 17,911,175 probably benign Het
Gmps T A 3: 63,993,954 I398N probably damaging Het
Igf2r A G 17: 12,698,527 V1556A probably benign Het
Il3ra T A 14: 14,350,967 N283K probably benign Het
Ist1 A G 8: 109,675,366 probably benign Het
Lama3 A T 18: 12,524,810 I1934F probably damaging Het
Lars A T 18: 42,202,697 M1118K possibly damaging Het
Lpin2 C T 17: 71,246,519 S846L probably damaging Het
Lrrc4b C A 7: 44,462,315 T537K probably damaging Het
Ltn1 G A 16: 87,405,519 probably benign Het
Meiob A G 17: 24,835,161 T401A probably benign Het
Mettl21e G A 1: 44,211,123 T41M probably damaging Het
Miga1 C T 3: 152,290,843 E323K probably damaging Het
Ndufs1 A T 1: 63,159,748 probably null Het
Olfr486 T C 7: 108,172,675 D23G probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parp6 T C 9: 59,632,925 Y274H probably damaging Het
Prom2 A T 2: 127,539,514 probably benign Het
Prune2 T A 19: 17,122,610 M1826K probably benign Het
Qk T A 17: 10,238,963 D159V probably damaging Het
Rab12 A T 17: 66,500,317 I139N probably damaging Het
Rab25 T A 3: 88,548,055 E7D probably benign Het
Rala A T 13: 17,888,589 V139E probably benign Het
Ralgapa2 A G 2: 146,388,487 probably benign Het
Rbl2 T A 8: 91,074,176 Y89N probably damaging Het
Rho A T 6: 115,932,227 I75F probably damaging Het
Slc38a4 C A 15: 97,008,949 A303S probably benign Het
Slc6a15 A G 10: 103,409,809 D551G probably null Het
Smyd3 T C 1: 179,043,872 N314S probably benign Het
Speer4f1 T A 5: 17,479,514 L180* probably null Het
Stat6 T C 10: 127,657,227 V576A probably damaging Het
Strn T C 17: 78,677,374 D127G possibly damaging Het
Syne1 T C 10: 5,033,096 R8610G probably benign Het
Tbc1d7 A C 13: 43,153,202 probably null Het
Tlr9 C A 9: 106,226,087 A859D probably benign Het
Tmem106c T A 15: 97,968,139 probably benign Het
Tmprss11c A T 5: 86,231,927 probably benign Het
Tnfsf18 A G 1: 161,494,731 R7G probably benign Het
Tnrc6b T A 15: 80,858,670 probably null Het
Trpm7 A T 2: 126,797,513 F1684I probably damaging Het
Ttbk1 C A 17: 46,478,938 R133L possibly damaging Het
Ttn A G 2: 76,721,342 S22962P probably damaging Het
Ube2q1 T A 3: 89,776,153 L135Q probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vwce T C 19: 10,659,973 probably benign Het
Wdhd1 A G 14: 47,267,068 S350P probably benign Het
Zbtb21 A G 16: 97,951,404 S560P probably damaging Het
Other mutations in Tcf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01798:Tcf3 APN 10 80413209 missense probably benign 0.30
IGL02676:Tcf3 APN 10 80421091 missense probably damaging 1.00
IGL03066:Tcf3 APN 10 80413045 missense probably damaging 0.97
R0401:Tcf3 UTSW 10 80421158 missense probably damaging 0.99
R0624:Tcf3 UTSW 10 80413334 missense probably damaging 1.00
R2114:Tcf3 UTSW 10 80410206 missense probably damaging 1.00
R5034:Tcf3 UTSW 10 80417543 missense possibly damaging 0.46
R5144:Tcf3 UTSW 10 80415237 missense probably damaging 0.98
R5347:Tcf3 UTSW 10 80410211 missense probably damaging 1.00
R5418:Tcf3 UTSW 10 80427683 missense probably damaging 1.00
R5771:Tcf3 UTSW 10 80421616 intron probably benign
R5786:Tcf3 UTSW 10 80419499 missense probably benign 0.06
R5941:Tcf3 UTSW 10 80413044 missense probably benign 0.06
R6857:Tcf3 UTSW 10 80416899 intron probably null
R6982:Tcf3 UTSW 10 80417550 missense probably damaging 1.00
R7178:Tcf3 UTSW 10 80421599 missense unknown
X0022:Tcf3 UTSW 10 80417458 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCACAGTGTAGCAAACTGGG -3'
(R):5'- AGGAAATCGCATCAGTAGCCGAC -3'

Sequencing Primer
(F):5'- AGGGACTGTCACTGCTCTG -3'
(R):5'- TTGGGCCATACACGCAC -3'
Posted On2013-04-16