Incidental Mutation 'R2216:Tnnt3'
ID241158
Institutional Source Beutler Lab
Gene Symbol Tnnt3
Ensembl Gene ENSMUSG00000061723
Gene Nametroponin T3, skeletal, fast
SynonymsfTnT, skeletal muscle fast-twitch TnT
MMRRC Submission 040218-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2216 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location142498836-142516009 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142512564 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 222 (Y222C)
Ref Sequence ENSEMBL: ENSMUSP00000101578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074187] [ENSMUST00000078497] [ENSMUST00000105941] [ENSMUST00000105942] [ENSMUST00000105943] [ENSMUST00000105944] [ENSMUST00000105945] [ENSMUST00000105946] [ENSMUST00000105947] [ENSMUST00000105948] [ENSMUST00000105949] [ENSMUST00000105950] [ENSMUST00000105952] [ENSMUST00000105953] [ENSMUST00000105954] [ENSMUST00000105955] [ENSMUST00000105957] [ENSMUST00000105958] [ENSMUST00000128294] [ENSMUST00000146804] [ENSMUST00000169299] [ENSMUST00000179658] [ENSMUST00000180152]
Predicted Effect probably benign
Transcript: ENSMUST00000074187
AA Change: Y198C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073815
Gene: ENSMUSG00000061723
AA Change: Y198C

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:Troponin 52 194 1.5e-42 PFAM
low complexity region 233 245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078497
AA Change: Y218C

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000077587
Gene: ENSMUSG00000061723
AA Change: Y218C

DomainStartEndE-ValueType
coiled coil region 1 48 N/A INTRINSIC
Pfam:Troponin 72 214 2.1e-42 PFAM
low complexity region 253 265 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105941
AA Change: Y198C

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000101561
Gene: ENSMUSG00000061723
AA Change: Y198C

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:Troponin 52 194 2.1e-42 PFAM
low complexity region 229 245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105942
AA Change: Y189C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101562
Gene: ENSMUSG00000061723
AA Change: Y189C

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:Troponin 43 185 1.7e-42 PFAM
low complexity region 224 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105943
AA Change: Y189C

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000101563
Gene: ENSMUSG00000061723
AA Change: Y189C

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:Troponin 43 185 1.9e-42 PFAM
low complexity region 220 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105944
AA Change: Y200C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101564
Gene: ENSMUSG00000061723
AA Change: Y200C

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:Troponin 54 196 2e-42 PFAM
low complexity region 235 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105945
AA Change: Y198C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101565
Gene: ENSMUSG00000061723
AA Change: Y198C

DomainStartEndE-ValueType
low complexity region 4 27 N/A INTRINSIC
Pfam:Troponin 52 194 1.5e-42 PFAM
low complexity region 233 245 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105946
AA Change: Y204C

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101566
Gene: ENSMUSG00000061723
AA Change: Y204C

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 58 200 1.8e-42 PFAM
low complexity region 235 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105947
AA Change: Y209C

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101567
Gene: ENSMUSG00000061723
AA Change: Y209C

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 63 205 1.9e-42 PFAM
low complexity region 240 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105948
AA Change: Y200C

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101568
Gene: ENSMUSG00000061723
AA Change: Y200C

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:Troponin 54 196 2.2e-42 PFAM
low complexity region 231 247 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105949
AA Change: Y194C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101569
Gene: ENSMUSG00000061723
AA Change: Y194C

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:Troponin 48 190 1.8e-42 PFAM
low complexity region 229 241 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105950
AA Change: Y212C

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101570
Gene: ENSMUSG00000061723
AA Change: Y212C

DomainStartEndE-ValueType
coiled coil region 3 42 N/A INTRINSIC
Pfam:Troponin 66 208 1.9e-42 PFAM
internal_repeat_1 213 240 4.67e-5 PROSPERO
low complexity region 247 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105952
AA Change: Y209C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101572
Gene: ENSMUSG00000061723
AA Change: Y209C

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 63 205 1.8e-42 PFAM
low complexity region 244 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105953
AA Change: Y212C

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000101573
Gene: ENSMUSG00000061723
AA Change: Y212C

DomainStartEndE-ValueType
coiled coil region 3 42 N/A INTRINSIC
Pfam:Troponin 66 208 1.9e-42 PFAM
low complexity region 247 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105954
AA Change: Y213C

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000101574
Gene: ENSMUSG00000061723
AA Change: Y213C

DomainStartEndE-ValueType
coiled coil region 1 44 N/A INTRINSIC
Pfam:Troponin 67 209 1.9e-42 PFAM
low complexity region 248 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105955
AA Change: Y205C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101575
Gene: ENSMUSG00000061723
AA Change: Y205C

DomainStartEndE-ValueType
coiled coil region 1 36 N/A INTRINSIC
Pfam:Troponin 59 201 2.2e-42 PFAM
low complexity region 240 252 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105957
AA Change: Y209C

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000101577
Gene: ENSMUSG00000061723
AA Change: Y209C

DomainStartEndE-ValueType
low complexity region 4 36 N/A INTRINSIC
Pfam:Troponin 63 205 1.8e-42 PFAM
low complexity region 244 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105958
AA Change: Y222C

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000101578
Gene: ENSMUSG00000061723
AA Change: Y222C

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 76 218 2.1e-42 PFAM
low complexity region 253 269 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125649
Predicted Effect probably benign
Transcript: ENSMUST00000128294
SMART Domains Protein: ENSMUSP00000116223
Gene: ENSMUSG00000061723

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:Troponin 49 107 3.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144259
Predicted Effect probably benign
Transcript: ENSMUST00000146804
AA Change: Y195C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000116087
Gene: ENSMUSG00000061723
AA Change: Y195C

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Troponin 49 191 1.4e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153262
Predicted Effect probably benign
Transcript: ENSMUST00000169299
AA Change: Y204C

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000127854
Gene: ENSMUSG00000061723
AA Change: Y204C

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 58 200 1.8e-42 PFAM
low complexity region 235 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179658
AA Change: Y222C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000136278
Gene: ENSMUSG00000061723
AA Change: Y222C

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 76 212 1.5e-36 PFAM
low complexity region 257 269 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180152
AA Change: Y222C

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000137111
Gene: ENSMUSG00000061723
AA Change: Y222C

DomainStartEndE-ValueType
coiled coil region 1 28 N/A INTRINSIC
Pfam:Troponin 76 218 5.1e-42 PFAM
internal_repeat_1 223 250 2.76e-5 PROSPERO
low complexity region 257 269 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The binding of Ca(2+) to the trimeric troponin complex initiates the process of muscle contraction. Increased Ca(2+) concentrations produce a conformational change in the troponin complex that is transmitted to tropomyosin dimers situated along actin filaments. The altered conformation permits increased interaction between a myosin head and an actin filament which, ultimately, produces a muscle contraction. The troponin complex has protein subunits C, I, and T. Subunit C binds Ca(2+) and subunit I binds to actin and inhibits actin-myosin interaction. Subunit T binds the troponin complex to the tropomyosin complex and is also required for Ca(2+)-mediated activation of actomyosin ATPase activity. There are 3 different troponin T genes that encode tissue-specific isoforms of subunit T for fast skeletal-, slow skeletal-, and cardiac-muscle. This gene encodes fast skeletal troponin T protein; also known as troponin T type 3. Alternative splicing results in multiple transcript variants encoding additional distinct troponin T type 3 isoforms. A developmentally regulated switch between fetal/neonatal and adult troponin T type 3 isoforms occurs. Additional splice variants have been described but their biological validity has not been established. Mutations in this gene may cause distal arthrogryposis multiplex congenita type 2B (DA2B). [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, decreased fetal weight, liver and kidney hemorrhage and thin diaphragm. Mice heterozygous for this allele exhibit growth retardation with mild skeleton defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aipl1 G T 11: 72,031,446 P146T probably damaging Het
Arnt2 T A 7: 84,275,351 T423S probably damaging Het
Bend5 A G 4: 111,448,590 N277S probably null Het
Cd22 G T 7: 30,867,046 T816N probably damaging Het
Cep126 G A 9: 8,120,678 R115C probably damaging Het
Cep85 T C 4: 134,131,430 H710R possibly damaging Het
Cmya5 A T 13: 93,093,495 L1695H probably damaging Het
Col24a1 T C 3: 145,314,981 V371A probably benign Het
Csmd1 T A 8: 17,027,339 probably null Het
Cyp1a1 T A 9: 57,702,069 probably null Het
Dennd1c C T 17: 57,074,492 probably null Het
Dmxl1 G A 18: 49,893,923 V2033I probably benign Het
Dtna A G 18: 23,569,565 H51R probably damaging Het
Dysf G A 6: 84,207,245 probably null Het
Gcn1l1 T A 5: 115,593,661 V945E probably benign Het
Gm12800 T A 4: 101,910,060 W169R probably damaging Het
Gpbar1 C G 1: 74,278,894 L99V probably damaging Het
Hdac9 A T 12: 34,429,517 D212E probably damaging Het
Itga1 A T 13: 114,997,029 D448E probably benign Het
Itga2b T A 11: 102,467,866 N75I probably benign Het
Klra7 T C 6: 130,228,586 E117G probably benign Het
Kmt2b G A 7: 30,574,065 R2349C probably benign Het
Masp1 T C 16: 23,492,055 N209S probably benign Het
Mybpc2 C T 7: 44,512,500 probably null Het
Myh15 C G 16: 49,165,838 S1557* probably null Het
Myo3a A C 2: 22,577,771 T346P probably benign Het
Nim1k A G 13: 119,714,215 Y152H probably damaging Het
Nrp2 C T 1: 62,762,918 R507* probably null Het
Olfr513 C T 7: 108,755,612 T252M probably damaging Het
Olfr702 T A 7: 106,823,998 H176L probably damaging Het
Parp14 T C 16: 35,857,205 I798V probably benign Het
Pcnx2 C T 8: 125,888,077 A212T probably benign Het
Pkhd1l1 A T 15: 44,573,895 H3522L probably damaging Het
Pram1 C T 17: 33,641,284 A275V probably benign Het
Prkag1 A T 15: 98,815,946 M1K probably null Het
Prss52 T C 14: 64,113,593 S276P probably damaging Het
Ranbp17 A T 11: 33,481,125 V284D probably damaging Het
Reln T C 5: 22,048,005 D648G probably benign Het
Rnf112 A G 11: 61,452,279 L190P probably damaging Het
Scn5a G T 9: 119,485,612 P2010Q probably benign Het
Scn5a T C 9: 119,513,085 Y1138C probably benign Het
Slc4a9 A G 18: 36,530,745 H274R probably benign Het
Slc5a6 T G 5: 31,039,335 E391D possibly damaging Het
Speer2 T C 16: 69,858,842 Q32R possibly damaging Het
Tars A G 15: 11,389,708 V372A probably benign Het
Thsd7a A T 6: 12,337,268 L1250Q possibly damaging Het
Trim40 T C 17: 36,888,983 I68V probably benign Het
Trp53tg5 T C 2: 164,471,306 I150V probably benign Het
Ube2u T C 4: 100,532,168 V109A probably benign Het
Usp54 A T 14: 20,561,840 D969E probably benign Het
Vil1 G T 1: 74,425,679 R495L probably benign Het
Wfs1 T A 5: 36,967,220 K700* probably null Het
Zcchc8 A G 5: 123,707,403 L298P probably damaging Het
Zfp946 A T 17: 22,454,716 Q150H possibly damaging Het
Other mutations in Tnnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02247:Tnnt3 APN 7 142508325 intron probably benign
IGL02376:Tnnt3 APN 7 142512558 missense possibly damaging 0.64
R0432:Tnnt3 UTSW 7 142512086 missense probably benign 0.09
R0463:Tnnt3 UTSW 7 142512335 missense probably benign 0.25
R1421:Tnnt3 UTSW 7 142511366 missense probably damaging 0.97
R1521:Tnnt3 UTSW 7 142515825 nonsense probably null
R1789:Tnnt3 UTSW 7 142512364 missense probably damaging 1.00
R1990:Tnnt3 UTSW 7 142511525 missense possibly damaging 0.78
R1991:Tnnt3 UTSW 7 142511525 missense possibly damaging 0.78
R2029:Tnnt3 UTSW 7 142512627 splice site probably benign
R4779:Tnnt3 UTSW 7 142514283 intron probably benign
R5568:Tnnt3 UTSW 7 142512040 missense probably damaging 0.98
R5756:Tnnt3 UTSW 7 142502758 critical splice donor site probably null
R5994:Tnnt3 UTSW 7 142511266 missense probably damaging 1.00
R6265:Tnnt3 UTSW 7 142501645 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTTAGCGATGACAAGCTGAGG -3'
(R):5'- AGCCAGGTCTCAAGGCAAAG -3'

Sequencing Primer
(F):5'- TCCCAGATCATGCAGGGC -3'
(R):5'- GTCTCAAGGCAAAGGCATGACC -3'
Posted On2014-10-15