Incidental Mutation 'R0165:Il3ra'
ID24123
Institutional Source Beutler Lab
Gene Symbol Il3ra
Ensembl Gene ENSMUSG00000068758
Gene Nameinterleukin 3 receptor, alpha chain
SynonymsIL-3 receptor alpha chain, CD123, SUT-1
MMRRC Submission 038441-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.035) question?
Stock #R0165 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location14346275-14356011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14350967 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 283 (N283K)
Ref Sequence ENSEMBL: ENSMUSP00000153358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090591] [ENSMUST00000223589] [ENSMUST00000224163] [ENSMUST00000224877] [ENSMUST00000225775]
Predicted Effect probably benign
Transcript: ENSMUST00000090591
AA Change: N283K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000088079
Gene: ENSMUSG00000068758
AA Change: N283K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:IL6Ra-bind 119 233 6.1e-33 PFAM
transmembrane domain 333 355 N/A INTRINSIC
low complexity region 359 374 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223589
Predicted Effect probably benign
Transcript: ENSMUST00000224163
AA Change: N283K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224415
Predicted Effect probably benign
Transcript: ENSMUST00000224877
AA Change: N190K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225560
Predicted Effect probably benign
Transcript: ENSMUST00000225775
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.5%
  • 10x: 96.2%
  • 20x: 91.4%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an interleukin 3 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL3 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL3. This gene and the gene encoding the colony stimulating factor 2 receptor alpha chain (CSF2RA) form a cytokine receptor gene cluster in a X-Y pseudoautosomal region on chromosomes X or Y. Alternatively spliced transcript variants encoding distinct isoforms have been found. [provided by RefSeq, Jun 2012]
PHENOTYPE: A number of distantly related inbred mouse strains carrying an identical spontaneous deletion at the branch point in intron 7 exhibit a reduced capacity of bone marrow cells to form colonies in response to interleukin-3 in CFU-GM assays. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,216,382 V1413M probably damaging Het
2700049A03Rik T C 12: 71,167,150 I717T possibly damaging Het
3632451O06Rik A G 14: 49,773,786 S155P probably benign Het
6430571L13Rik A G 9: 107,346,184 probably benign Het
Abca15 T A 7: 120,350,903 probably benign Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Adgrl2 A G 3: 148,852,863 probably benign Het
Agap3 A G 5: 24,479,745 T544A probably damaging Het
Ahrr G A 13: 74,283,024 probably benign Het
Akr1c20 T C 13: 4,523,296 T7A probably benign Het
Ankrd26 A G 6: 118,540,484 S459P probably benign Het
Ascc3 T A 10: 50,842,127 probably null Het
Brd1 T C 15: 88,729,777 N305S probably damaging Het
Catip T A 1: 74,368,469 L320Q possibly damaging Het
Cttnbp2 G A 6: 18,435,410 Q150* probably null Het
Cyp2d22 T G 15: 82,373,280 N228T probably benign Het
Dapk1 T C 13: 60,761,593 V1340A probably benign Het
Dcaf4 G A 12: 83,535,988 probably benign Het
Ddhd1 G A 14: 45,595,592 T849M probably damaging Het
Dnah6 A G 6: 73,021,323 S3987P probably benign Het
Dst C A 1: 34,154,646 probably benign Het
Epha2 T C 4: 141,321,892 probably null Het
Ern2 T C 7: 122,179,779 T281A probably benign Het
Extl1 A G 4: 134,357,703 F652S probably damaging Het
Gckr A G 5: 31,326,948 S541G possibly damaging Het
Gdap1l1 A G 2: 163,451,499 probably null Het
Gm7535 T C 17: 17,911,175 probably benign Het
Gmps T A 3: 63,993,954 I398N probably damaging Het
Igf2r A G 17: 12,698,527 V1556A probably benign Het
Ist1 A G 8: 109,675,366 probably benign Het
Lama3 A T 18: 12,524,810 I1934F probably damaging Het
Lars A T 18: 42,202,697 M1118K possibly damaging Het
Lpin2 C T 17: 71,246,519 S846L probably damaging Het
Lrrc4b C A 7: 44,462,315 T537K probably damaging Het
Ltn1 G A 16: 87,405,519 probably benign Het
Meiob A G 17: 24,835,161 T401A probably benign Het
Mettl21e G A 1: 44,211,123 T41M probably damaging Het
Miga1 C T 3: 152,290,843 E323K probably damaging Het
Ndufs1 A T 1: 63,159,748 probably null Het
Olfr486 T C 7: 108,172,675 D23G probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Parp6 T C 9: 59,632,925 Y274H probably damaging Het
Prom2 A T 2: 127,539,514 probably benign Het
Prune2 T A 19: 17,122,610 M1826K probably benign Het
Qk T A 17: 10,238,963 D159V probably damaging Het
Rab12 A T 17: 66,500,317 I139N probably damaging Het
Rab25 T A 3: 88,548,055 E7D probably benign Het
Rala A T 13: 17,888,589 V139E probably benign Het
Ralgapa2 A G 2: 146,388,487 probably benign Het
Rbl2 T A 8: 91,074,176 Y89N probably damaging Het
Rho A T 6: 115,932,227 I75F probably damaging Het
Slc38a4 C A 15: 97,008,949 A303S probably benign Het
Slc6a15 A G 10: 103,409,809 D551G probably null Het
Smyd3 T C 1: 179,043,872 N314S probably benign Het
Speer4f1 T A 5: 17,479,514 L180* probably null Het
Stat6 T C 10: 127,657,227 V576A probably damaging Het
Strn T C 17: 78,677,374 D127G possibly damaging Het
Syne1 T C 10: 5,033,096 R8610G probably benign Het
Tbc1d7 A C 13: 43,153,202 probably null Het
Tcf3 C T 10: 80,412,997 R548Q probably damaging Het
Tlr9 C A 9: 106,226,087 A859D probably benign Het
Tmem106c T A 15: 97,968,139 probably benign Het
Tmprss11c A T 5: 86,231,927 probably benign Het
Tnfsf18 A G 1: 161,494,731 R7G probably benign Het
Tnrc6b T A 15: 80,858,670 probably null Het
Trpm7 A T 2: 126,797,513 F1684I probably damaging Het
Ttbk1 C A 17: 46,478,938 R133L possibly damaging Het
Ttn A G 2: 76,721,342 S22962P probably damaging Het
Ube2q1 T A 3: 89,776,153 L135Q probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vwce T C 19: 10,659,973 probably benign Het
Wdhd1 A G 14: 47,267,068 S350P probably benign Het
Zbtb21 A G 16: 97,951,404 S560P probably damaging Het
Other mutations in Il3ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02454:Il3ra APN 14 14351113 missense probably benign 0.36
IGL02547:Il3ra APN 14 14351970 missense probably benign 0.01
IGL02550:Il3ra APN 14 14348055 missense probably benign 0.03
IGL02632:Il3ra APN 14 14350807 critical splice donor site probably null
IGL02737:Il3ra APN 14 14350760 missense probably benign 0.02
R0597:Il3ra UTSW 14 14351166 critical splice donor site probably null
R1109:Il3ra UTSW 14 14349317 missense probably damaging 1.00
R2211:Il3ra UTSW 14 14355029 missense probably benign 0.03
R2409:Il3ra UTSW 14 14349377 splice site probably null
R4258:Il3ra UTSW 14 14347961 missense probably damaging 1.00
R4896:Il3ra UTSW 14 14355381 missense probably benign 0.07
R4994:Il3ra UTSW 14 14351080 missense probably benign 0.19
R5004:Il3ra UTSW 14 14355381 missense probably benign 0.07
R5935:Il3ra UTSW 14 14350799 missense probably damaging 0.99
R6274:Il3ra UTSW 14 14350180 missense probably benign 0.19
R6350:Il3ra UTSW 14 14348903 missense probably benign 0.07
R6403:Il3ra UTSW 14 14347137 missense probably damaging 0.98
R6845:Il3ra UTSW 14 14346517 splice site probably null
Z1088:Il3ra UTSW 14 14351129 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACTATGCACTAACATGCGTCGCC -3'
(R):5'- TGAGCTTCCGAGGGTAAACCTCTG -3'

Sequencing Primer
(F):5'- AACATGCGTCGCCCTACTG -3'
(R):5'- AGGGTAAACCTCTGACCTCG -3'
Posted On2013-04-16