Incidental Mutation 'R2218:Appl2'
ID 241270
Institutional Source Beutler Lab
Gene Symbol Appl2
Ensembl Gene ENSMUSG00000020263
Gene Name adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2
Synonyms Dip3b
MMRRC Submission 040220-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2218 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 83435897-83484602 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 83444601 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 472 (F472L)
Ref Sequence ENSEMBL: ENSMUSP00000020500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020500]
AlphaFold Q8K3G9
Predicted Effect possibly damaging
Transcript: ENSMUST00000020500
AA Change: F472L

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020500
Gene: ENSMUSG00000020263
AA Change: F472L

DomainStartEndE-ValueType
Pfam:BAR_3 7 248 6.4e-69 PFAM
PH 278 377 1.2e-7 SMART
Pfam:PTB 491 613 6e-7 PFAM
Pfam:PID 492 611 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150351
Predicted Effect probably benign
Transcript: ENSMUST00000176675
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of two effectors of the small GTPase RAB5A/Rab5, which are involved in a signal transduction pathway. Both effectors contain an N-terminal Bin/Amphiphysin/Rvs (BAR) domain, a central pleckstrin homology (PH) domain, and a C-terminal phosphotyrosine binding (PTB) domain, and they bind the Rab5 through the BAR domain. They are associated with endosomal membranes and can be translocated to the nucleus in response to the EGF stimulus. They interact with the NuRD/MeCP1 complex (nucleosome remodeling and deacetylase /methyl-CpG-binding protein 1 complex) and are required for efficient cell proliferation. A chromosomal aberration t(12;22)(q24.1;q13.3) involving this gene and the PSAP2 gene results in 22q13.3 deletion syndrome, also known as Phelan-McDermid syndrome. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele display altered red blood cell physiology. Mutant MEFs exhibit defects in HGF-induced Akt activation, migration, and invasion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abitram G T 4: 56,802,693 (GRCm39) V26L probably damaging Het
Acap3 A G 4: 155,988,319 (GRCm39) probably null Het
Atp13a5 A T 16: 29,140,464 (GRCm39) V319D probably damaging Het
Atxn2 T C 5: 121,941,140 (GRCm39) Y56H probably damaging Het
Brinp1 A G 4: 68,680,952 (GRCm39) L526P probably damaging Het
Cacna1d C T 14: 29,845,048 (GRCm39) D679N probably damaging Het
Canx C T 11: 50,201,694 (GRCm39) V59I probably benign Het
Drd2 T C 9: 49,311,094 (GRCm39) V115A probably damaging Het
Eml6 T A 11: 29,768,907 (GRCm39) Q746L probably damaging Het
F13b G T 1: 139,434,582 (GRCm39) S116I probably benign Het
Flt4 T A 11: 49,515,555 (GRCm39) S48T probably benign Het
Gcn1 C A 5: 115,757,720 (GRCm39) S2475Y probably benign Het
Gls2 T C 10: 128,040,583 (GRCm39) L328P probably damaging Het
Gm7535 A G 17: 18,131,936 (GRCm39) probably benign Het
Htr3a T C 9: 48,819,911 (GRCm39) Y73C probably damaging Het
Iapp G A 6: 142,249,096 (GRCm39) A50T probably benign Het
Il10ra T C 9: 45,176,914 (GRCm39) D137G probably benign Het
Krt35 T C 11: 99,986,988 (GRCm39) S9G probably null Het
Lamc2 T A 1: 153,006,525 (GRCm39) R875S probably benign Het
Mcoln1 C A 8: 3,555,813 (GRCm39) T36K possibly damaging Het
Muc6 T C 7: 141,233,227 (GRCm39) H885R probably benign Het
Nsrp1 A T 11: 76,936,587 (GRCm39) Y536* probably null Het
Or10al4 A T 17: 38,037,145 (GRCm39) I77F probably damaging Het
Polr2a A G 11: 69,633,511 (GRCm39) probably null Het
Pp2d1 C A 17: 53,822,482 (GRCm39) V195L probably benign Het
Rag1 T C 2: 101,474,491 (GRCm39) H217R probably benign Het
Ramp2 A G 11: 101,138,457 (GRCm39) E86G probably benign Het
Rcbtb2 T C 14: 73,416,005 (GRCm39) probably null Het
Sema5a A T 15: 32,631,455 (GRCm39) I613F probably damaging Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Slc39a11 C A 11: 113,450,376 (GRCm39) probably null Het
Slc47a2 T C 11: 61,204,497 (GRCm39) T285A probably benign Het
Timd2 T A 11: 46,577,844 (GRCm39) I96L probably damaging Het
Tkt G T 14: 30,289,018 (GRCm39) probably null Het
Tle1 A T 4: 72,117,556 (GRCm39) F35I possibly damaging Het
Tmem64 T C 4: 15,266,658 (GRCm39) I236T possibly damaging Het
Ttll13 A G 7: 79,902,250 (GRCm39) K109R probably damaging Het
Virma T C 4: 11,544,924 (GRCm39) S1628P probably damaging Het
Zan C A 5: 137,408,568 (GRCm39) probably benign Het
Zbtb22 T G 17: 34,136,939 (GRCm39) D361E probably damaging Het
Zfp608 T C 18: 55,120,756 (GRCm39) N277S probably benign Het
Other mutations in Appl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Appl2 APN 10 83,450,165 (GRCm39) missense possibly damaging 0.95
IGL01794:Appl2 APN 10 83,450,158 (GRCm39) missense probably benign
IGL01887:Appl2 APN 10 83,457,386 (GRCm39) unclassified probably benign
IGL03071:Appl2 APN 10 83,476,970 (GRCm39) critical splice acceptor site probably null
IGL03077:Appl2 APN 10 83,457,623 (GRCm39) unclassified probably benign
R0006:Appl2 UTSW 10 83,438,762 (GRCm39) missense probably damaging 1.00
R0006:Appl2 UTSW 10 83,438,762 (GRCm39) missense probably damaging 1.00
R0591:Appl2 UTSW 10 83,460,509 (GRCm39) missense possibly damaging 0.94
R1695:Appl2 UTSW 10 83,457,446 (GRCm39) missense probably damaging 0.99
R2217:Appl2 UTSW 10 83,444,601 (GRCm39) missense possibly damaging 0.47
R4782:Appl2 UTSW 10 83,436,855 (GRCm39) missense probably damaging 1.00
R4889:Appl2 UTSW 10 83,476,922 (GRCm39) missense probably damaging 1.00
R5109:Appl2 UTSW 10 83,436,871 (GRCm39) missense probably benign 0.06
R5460:Appl2 UTSW 10 83,438,696 (GRCm39) missense probably benign 0.00
R5512:Appl2 UTSW 10 83,441,682 (GRCm39) missense probably damaging 1.00
R6023:Appl2 UTSW 10 83,484,393 (GRCm39) missense probably null 0.00
R6047:Appl2 UTSW 10 83,448,765 (GRCm39) critical splice acceptor site probably null
R7403:Appl2 UTSW 10 83,450,059 (GRCm39) missense probably benign 0.00
R7537:Appl2 UTSW 10 83,453,292 (GRCm39) missense possibly damaging 0.69
R8488:Appl2 UTSW 10 83,446,866 (GRCm39) missense probably benign 0.02
R9203:Appl2 UTSW 10 83,476,879 (GRCm39) nonsense probably null
X0027:Appl2 UTSW 10 83,457,418 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTAAAGCTAAAATGGCCTTCC -3'
(R):5'- AGAATTCCTTGACCAGAACAGGG -3'

Sequencing Primer
(F):5'- ACAGGACTTCTCACGTTC -3'
(R):5'- CAGGGGTGGCAGGTAATACC -3'
Posted On 2014-10-15