Incidental Mutation 'R2219:Adgre1'
ID241386
Institutional Source Beutler Lab
Gene Symbol Adgre1
Ensembl Gene ENSMUSG00000004730
Gene Nameadhesion G protein-coupled receptor E1
SynonymsEmr1, EGF-TM7, F4/80, DD7A5-7, TM7LN3, Ly71
MMRRC Submission 040221-MU
Accession Numbers

Ncbi RefSeq: NM_010130.4 ;MGI:106912

Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R2219 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location57358686-57483529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57401912 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 34 (N34K)
Ref Sequence ENSEMBL: ENSMUSP00000083971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004850] [ENSMUST00000086763]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004850
AA Change: N34K

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000004850
Gene: ENSMUSG00000004730
AA Change: N34K

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000086763
AA Change: N34K

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083971
Gene: ENSMUSG00000004730
AA Change: N34K

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
EGF 35 80 1.43e-1 SMART
EGF_CA 81 122 3.59e-7 SMART
EGF_CA 133 172 4.56e-9 SMART
EGF_CA 173 221 1.29e-8 SMART
EGF_CA 222 271 2.31e-10 SMART
EGF_CA 272 318 1.06e-9 SMART
EGF_CA 319 367 1.18e-7 SMART
GPS 591 641 2.57e-19 SMART
Pfam:7tm_2 644 885 2.1e-63 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype Strain: 3582333
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that has a domain resembling seven transmembrane G protein-coupled hormone receptors (7TM receptors) at its C-terminus. The N-terminus of the encoded protein has six EGF-like modules, separated from the transmembrane segments by a serine/threonine-rich domain, a feature reminiscent of mucin-like, single-span, integral membrane glycoproteins with adhesive properties. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice fail to develop peripheral tolerance after inoculation with antigen because of a lack of efferent regulatory T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Chemically induced(1)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik A G 7: 42,446,345 Y160H probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Ago2 T A 15: 73,146,411 E59D probably benign Het
Akap8l G T 17: 32,334,631 Q372K probably benign Het
Aox2 A G 1: 58,349,130 probably null Het
Apc2 T C 10: 80,309,109 V618A probably benign Het
Cacna1d A T 14: 30,042,090 C2140S probably damaging Het
Cadps2 A G 6: 23,410,832 L671P probably damaging Het
Capn9 C T 8: 124,609,159 R529* probably null Het
Ccdc180 T A 4: 45,944,949 N1452K probably damaging Het
Cdh5 A T 8: 104,142,906 I755F possibly damaging Het
Cdkal1 T A 13: 29,354,758 M473L probably benign Het
Cfap65 T C 1: 74,904,025 I1614V probably damaging Het
Champ1 A G 8: 13,880,017 H725R probably damaging Het
Cntnap5a A T 1: 116,580,639 T1294S possibly damaging Het
Cops8 A C 1: 90,606,619 N94T probably benign Het
Cpne7 G T 8: 123,124,438 V155L probably benign Het
Dhx29 T C 13: 112,952,804 V703A probably damaging Het
Dhx30 A G 9: 110,087,635 L575P probably damaging Het
Dmc1 T A 15: 79,585,126 H156L possibly damaging Het
Dnmt3a A G 12: 3,849,654 probably benign Het
Dst C G 1: 34,170,433 L869V probably damaging Het
Eif3d A T 15: 77,964,942 M180K probably benign Het
Erbb3 T C 10: 128,569,871 T1173A probably damaging Het
Fat4 A T 3: 39,010,215 K4773N probably damaging Het
Fbn2 G A 18: 58,052,963 P1771L possibly damaging Het
Fer1l4 T G 2: 156,031,764 Y1207S probably damaging Het
Fermt2 G A 14: 45,475,897 T87I probably benign Het
Fpr3 T A 17: 17,971,382 M305K possibly damaging Het
Fzd2 A G 11: 102,605,423 E231G probably benign Het
Ggcx T C 6: 72,427,982 Y458H probably benign Het
Ggt7 A G 2: 155,495,719 S504P probably damaging Het
Gm14548 A T 7: 3,897,489 N87K probably benign Het
Gm4884 A G 7: 41,043,486 H293R possibly damaging Het
Gm5475 A G 15: 100,424,213 probably benign Het
Gm5930 A T 14: 44,336,536 L115M probably damaging Het
Itln1 T A 1: 171,531,547 T122S probably damaging Het
Itpr3 T A 17: 27,115,053 L2033Q probably benign Het
Lama2 T C 10: 27,043,569 D2222G probably damaging Het
Lars2 T C 9: 123,418,780 L334P probably damaging Het
Ly9 T C 1: 171,597,681 probably null Het
Man1a T C 10: 53,977,049 I324M probably damaging Het
Mast3 T C 8: 70,780,963 E994G probably damaging Het
Mettl21a A T 1: 64,616,283 V46E probably damaging Het
Mmp15 A G 8: 95,370,173 D398G probably benign Het
Mybpc1 T A 10: 88,555,678 D319V probably damaging Het
Olfr1154 A C 2: 87,902,925 Y250* probably null Het
Olfr1251 A T 2: 89,667,867 N6K possibly damaging Het
Olfr1256 A T 2: 89,835,425 D173E probably damaging Het
Olfr1260 G A 2: 89,977,912 V45I possibly damaging Het
Olfr1314 A T 2: 112,092,407 I98N probably damaging Het
Olfr1467 T A 19: 13,365,537 I303N possibly damaging Het
Olfr288 T A 15: 98,186,967 K277* probably null Het
Olfr467 G A 7: 107,815,222 V213I probably benign Het
Otogl C T 10: 107,856,977 C882Y probably damaging Het
Parp10 A G 15: 76,233,583 Y868H probably damaging Het
Pick1 T A 15: 79,239,699 I90N probably damaging Het
Piezo1 C T 8: 122,491,488 V1170I probably benign Het
Pim3 G A 15: 88,862,912 V54I possibly damaging Het
Pinlyp T C 7: 24,546,008 probably benign Het
Ppfia3 G A 7: 45,354,890 Q473* probably null Het
Rab3gap2 G A 1: 185,275,916 G1056E probably damaging Het
Ralgapa2 G A 2: 146,421,679 T706I probably benign Het
Reln T C 5: 21,972,047 T1874A possibly damaging Het
Rftn1 C A 17: 50,169,145 M1I probably null Het
Ros1 T A 10: 52,166,079 Q250L probably damaging Het
Slc11a1 T A 1: 74,380,665 F166I probably damaging Het
Slc17a9 A G 2: 180,731,962 T59A probably benign Het
Slc26a5 T C 5: 21,823,478 K364R probably damaging Het
Slitrk2 T C X: 66,655,148 I415T probably damaging Het
Stom A G 2: 35,321,601 I136T possibly damaging Het
Strc G T 2: 121,364,523 P1728T probably damaging Het
Telo2 C A 17: 25,103,699 V640F probably benign Het
Tg T C 15: 66,681,933 V399A probably benign Het
Tmem214 A G 5: 30,873,631 K383E possibly damaging Het
Tomm40l A T 1: 171,221,981 L13* probably null Het
Tonsl A T 15: 76,634,640 N526K probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Tymp T A 15: 89,374,762 M240L probably benign Het
Ubr2 A T 17: 46,986,042 S271T possibly damaging Het
Uggt2 A T 14: 119,075,337 N353K probably damaging Het
Ugt2b35 T A 5: 87,003,332 F266I possibly damaging Het
Vmn2r103 C T 17: 19,793,647 R234W probably damaging Het
Zfp109 C A 7: 24,228,461 D508Y probably damaging Het
Zfp623 T C 15: 75,947,530 S112P possibly damaging Het
Zfp735 A G 11: 73,711,025 N265S possibly damaging Het
Zfp879 A G 11: 50,833,267 C321R probably damaging Het
Other mutations in Adgre1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adgre1 APN 17 57450055 missense probably benign 0.00
IGL00966:Adgre1 APN 17 57419335 missense probably benign 0.04
IGL01680:Adgre1 APN 17 57402620 missense unknown
IGL01724:Adgre1 APN 17 57444064 nonsense probably null
IGL02172:Adgre1 APN 17 57478879 missense probably damaging 1.00
IGL02260:Adgre1 APN 17 57447891 missense probably benign 0.01
IGL02272:Adgre1 APN 17 57450021 nonsense probably null
IGL02336:Adgre1 APN 17 57411024 nonsense probably null
IGL02346:Adgre1 APN 17 57443919 missense probably benign 0.15
IGL02398:Adgre1 APN 17 57402824 nonsense probably null
IGL02618:Adgre1 APN 17 57444021 missense possibly damaging 0.66
IGL02690:Adgre1 APN 17 57480921 missense probably damaging 1.00
IGL02936:Adgre1 APN 17 57478833 missense probably benign 0.26
IGL03112:Adgre1 APN 17 57448029 splice site probably null
IGL03350:Adgre1 APN 17 57401908 missense probably benign 0.16
F480 UTSW 17 57444063 missense probably damaging 1.00
lomax UTSW 17 57402811 missense unknown
Onion UTSW 17 57402841 nonsense probably null
Scallion UTSW 17 57401977 missense possibly damaging 0.90
R0049:Adgre1 UTSW 17 57402841 nonsense probably null
R0153:Adgre1 UTSW 17 57443939 missense possibly damaging 0.92
R0277:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0278:Adgre1 UTSW 17 57447872 missense probably benign 0.07
R0323:Adgre1 UTSW 17 57444060 missense probably benign 0.00
R0389:Adgre1 UTSW 17 57406839 missense possibly damaging 0.80
R0492:Adgre1 UTSW 17 57402742 missense unknown
R0621:Adgre1 UTSW 17 57441359 missense probably damaging 0.98
R0647:Adgre1 UTSW 17 57411003 missense probably damaging 1.00
R1310:Adgre1 UTSW 17 57447936 missense probably benign 0.00
R1601:Adgre1 UTSW 17 57441353 missense probably benign 0.01
R1689:Adgre1 UTSW 17 57449921 missense probably benign 0.31
R1708:Adgre1 UTSW 17 57401974 missense possibly damaging 0.93
R1796:Adgre1 UTSW 17 57441350 missense probably benign 0.43
R1839:Adgre1 UTSW 17 57441299 missense probably benign 0.00
R1860:Adgre1 UTSW 17 57441363 missense probably benign 0.00
R2165:Adgre1 UTSW 17 57419338 missense probably damaging 0.97
R2519:Adgre1 UTSW 17 57410956 missense probably damaging 1.00
R3874:Adgre1 UTSW 17 57401925 missense probably benign 0.08
R3911:Adgre1 UTSW 17 57447860 missense probably damaging 1.00
R4190:Adgre1 UTSW 17 57402811 missense unknown
R4439:Adgre1 UTSW 17 57447954 missense probably damaging 1.00
R4513:Adgre1 UTSW 17 57410947 missense probably benign 0.34
R4529:Adgre1 UTSW 17 57420519 missense possibly damaging 0.92
R4543:Adgre1 UTSW 17 57406874 missense probably benign 0.07
R4610:Adgre1 UTSW 17 57450073 missense possibly damaging 0.50
R4665:Adgre1 UTSW 17 57480947 missense probably benign 0.20
R4911:Adgre1 UTSW 17 57447832 missense possibly damaging 0.57
R4928:Adgre1 UTSW 17 57444064 nonsense probably null
R4942:Adgre1 UTSW 17 57406903 missense probably damaging 1.00
R4946:Adgre1 UTSW 17 57443918 missense probably benign 0.33
R4953:Adgre1 UTSW 17 57441321 missense probably damaging 0.99
R5107:Adgre1 UTSW 17 57401977 missense possibly damaging 0.90
R5366:Adgre1 UTSW 17 57402817 missense probably benign 0.39
R5590:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R5619:Adgre1 UTSW 17 57420437 missense probably benign 0.15
R5699:Adgre1 UTSW 17 57481007 missense probably benign 0.43
R5734:Adgre1 UTSW 17 57443990 missense probably benign 0.00
R5860:Adgre1 UTSW 17 57445034 missense probably damaging 1.00
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6039:Adgre1 UTSW 17 57406859 missense probably benign 0.28
R6149:Adgre1 UTSW 17 57445018 missense probably benign 0.08
R6478:Adgre1 UTSW 17 57401955 missense possibly damaging 0.81
R6709:Adgre1 UTSW 17 57406917 missense probably benign 0.10
R6864:Adgre1 UTSW 17 57478879 missense probably damaging 1.00
R6945:Adgre1 UTSW 17 57410844 missense probably benign 0.01
R6945:Adgre1 UTSW 17 57420399 missense probably benign 0.39
R6988:Adgre1 UTSW 17 57408445 missense probably benign 0.00
R7019:Adgre1 UTSW 17 57410945 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATGCTTGTCTCTAGGCTGTTC -3'
(R):5'- ATTAAGCTGCCTGAGTGTGATG -3'

Sequencing Primer
(F):5'- GTCTCTAGGCTGTTCTTCTAAAAAC -3'
(R):5'- ATGTTTATTCATGTCTCCCCAGGAAG -3'
Posted On2014-10-15