Incidental Mutation 'R2220:Cfap61'
ID241402
Institutional Source Beutler Lab
Gene Symbol Cfap61
Ensembl Gene ENSMUSG00000037143
Gene Namecilia and flagella associated protein 61
Synonyms4930529M08Rik
MMRRC Submission 040222-MU
Accession Numbers

Genbank: NM_175280.3; Ensemble: ENSMUST00000133433

Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R2220 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location145934784-146215039 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) G to A at 146036816 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126415] [ENSMUST00000133433]
Predicted Effect probably null
Transcript: ENSMUST00000126415
SMART Domains Protein: ENSMUSP00000118626
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
SCOP:d1b87a_ 183 244 1e-5 SMART
low complexity region 355 368 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000133433
SMART Domains Protein: ENSMUSP00000118411
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
Pfam:DUF4821 15 272 1.1e-96 PFAM
low complexity region 355 368 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 1172 1182 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155214
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,875,530 probably null Het
Aadacl4 T C 4: 144,618,002 I116T probably damaging Het
Aatk G T 11: 120,012,177 F407L probably damaging Het
Abca8a A T 11: 110,026,855 L1586Q probably damaging Het
Aox2 A G 1: 58,349,130 probably null Het
Ap5m1 A G 14: 49,081,095 D420G probably damaging Het
Bcl6 A T 16: 23,972,632 L324* probably null Het
Bicc1 A G 10: 70,950,125 S396P probably damaging Het
Ccdc83 G A 7: 90,259,514 S4L probably damaging Het
Cdkal1 T A 13: 29,354,758 M473L probably benign Het
Cep85 T C 4: 134,153,867 H363R probably damaging Het
Cfap65 T C 1: 74,904,025 I1614V probably damaging Het
Cluh T A 11: 74,667,121 F1062I probably damaging Het
Cntnap5a A T 1: 116,580,639 T1294S possibly damaging Het
Cops8 A C 1: 90,606,619 N94T probably benign Het
Csmd1 T C 8: 15,992,641 D2364G possibly damaging Het
Cyb5d1 T C 11: 69,395,045 D55G probably benign Het
Cyp2c29 A T 19: 39,287,232 I39F probably benign Het
Cyp2j8 T C 4: 96,444,625 S495G probably benign Het
Dhx30 A G 9: 110,087,635 L575P probably damaging Het
Dnah7a C T 1: 53,521,174 V2113I probably benign Het
Dusp3 T C 11: 101,974,805 N95D probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam208b A T 13: 3,581,872 N876K probably benign Het
Fer1l4 T G 2: 156,031,764 Y1207S probably damaging Het
Flg2 T G 3: 93,202,185 S507A unknown Het
Gdf6 A G 4: 9,844,770 H98R probably damaging Het
Ggnbp2 T C 11: 84,836,613 N63S possibly damaging Het
Ggt7 A G 2: 155,495,719 S504P probably damaging Het
Gm14548 A T 7: 3,897,489 N87K probably benign Het
Gtf2h5 G A 17: 6,084,578 E48K probably benign Het
Hivep3 T G 4: 119,734,038 V81G possibly damaging Het
Igsf21 A G 4: 140,028,114 M410T probably damaging Het
Insrr T C 3: 87,809,418 L651P probably damaging Het
Iqcb1 A T 16: 36,843,462 probably null Het
Klhdc7a G A 4: 139,965,453 R728C probably benign Het
Lars2 T C 9: 123,418,780 L334P probably damaging Het
Mast3 T C 8: 70,780,963 E994G probably damaging Het
Mertk T A 2: 128,801,472 N930K probably benign Het
Mettl21a A T 1: 64,616,283 V46E probably damaging Het
Nedd4 T A 9: 72,736,707 C614S probably damaging Het
Olfr168 A T 16: 19,530,145 Y258* probably null Het
Olfr173 G T 16: 58,797,624 A74D possibly damaging Het
Olfr525 T C 7: 140,323,571 S291P probably benign Het
Pard3b C T 1: 62,479,683 R976* probably null Het
Pcdhb16 A G 18: 37,478,967 T327A probably benign Het
Ppp1r37 C A 7: 19,532,446 R465L probably null Het
Ppp3ca C A 3: 136,797,924 T86K probably damaging Het
Ralgapa2 G A 2: 146,421,679 T706I probably benign Het
Rnf213 T C 11: 119,436,428 L1747P possibly damaging Het
Slc11a1 T A 1: 74,380,665 F166I probably damaging Het
Slc25a18 G A 6: 120,793,557 probably null Het
Stt3a A G 9: 36,749,551 probably null Het
Supt16 G A 14: 52,172,144 R770* probably null Het
Syde2 A G 3: 146,001,958 I551V probably benign Het
Tecta T C 9: 42,392,030 D102G probably damaging Het
Tmc7 A T 7: 118,552,816 I294N possibly damaging Het
Tmem174 T C 13: 98,637,259 Y21C probably damaging Het
Tomm40l A T 1: 171,221,981 L13* probably null Het
Trim30c A G 7: 104,383,267 V284A probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Uggt2 A T 14: 119,075,337 N353K probably damaging Het
Vps13d C T 4: 145,178,320 V79M probably damaging Het
Wfdc18 C T 11: 83,709,913 R45* probably null Het
Other mutations in Cfap61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02838:Cfap61 APN 2 145947164 nonsense probably null
IGL03024:Cfap61 APN 2 145939999 splice site probably benign
1mM(1):Cfap61 UTSW 2 146200760 missense probably damaging 1.00
R0006:Cfap61 UTSW 2 146077312 missense probably benign 0.06
R0396:Cfap61 UTSW 2 145949944 missense possibly damaging 0.88
R0458:Cfap61 UTSW 2 146008917 missense probably benign 0.08
R0477:Cfap61 UTSW 2 145939916 missense probably damaging 1.00
R0513:Cfap61 UTSW 2 146035295 missense possibly damaging 0.93
R1104:Cfap61 UTSW 2 145951061 nonsense probably null
R1413:Cfap61 UTSW 2 145963443 missense probably benign 0.27
R1591:Cfap61 UTSW 2 146145458 missense probably benign 0.17
R1599:Cfap61 UTSW 2 146012163 missense probably benign
R1661:Cfap61 UTSW 2 146035319 splice site probably null
R1665:Cfap61 UTSW 2 146035319 splice site probably null
R1789:Cfap61 UTSW 2 145939993 critical splice donor site probably null
R1800:Cfap61 UTSW 2 146042622 missense probably damaging 1.00
R2050:Cfap61 UTSW 2 146145473 missense probably benign 0.26
R2202:Cfap61 UTSW 2 146214680 missense probably damaging 1.00
R2444:Cfap61 UTSW 2 146035319 splice site probably null
R3779:Cfap61 UTSW 2 145950794 missense probably damaging 1.00
R4668:Cfap61 UTSW 2 146143136 missense probably damaging 0.99
R4705:Cfap61 UTSW 2 146035202 missense probably damaging 1.00
R4763:Cfap61 UTSW 2 146017367 missense probably benign 0.00
R4816:Cfap61 UTSW 2 146143100 missense probably damaging 1.00
R5067:Cfap61 UTSW 2 146102036 missense probably damaging 0.99
R5120:Cfap61 UTSW 2 146143160 nonsense probably null
R5308:Cfap61 UTSW 2 146109988 missense probably damaging 0.99
R5575:Cfap61 UTSW 2 146017393 missense probably benign 0.31
R5834:Cfap61 UTSW 2 146129149 missense probably benign 0.29
R5959:Cfap61 UTSW 2 145947133 missense probably benign 0.00
R6190:Cfap61 UTSW 2 145947133 missense probably benign 0.00
R6283:Cfap61 UTSW 2 146129102 unclassified probably null
R6786:Cfap61 UTSW 2 146045443 missense possibly damaging 0.84
X0022:Cfap61 UTSW 2 146129090 missense probably benign 0.28
Z1088:Cfap61 UTSW 2 146129227 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- ACTTGAAGGAGTGTTCTCTAAGAC -3'
(R):5'- GCAATAATGCTTCAAAGAGGCAC -3'

Sequencing Primer
(F):5'- TCTTCAAGAGAACTGGGCTCAG -3'
(R):5'- CTTCAAAGAGGCACGACGTG -3'
Posted On2014-10-15