Incidental Mutation 'R2220:Dhx30'
ID241436
Institutional Source Beutler Lab
Gene Symbol Dhx30
Ensembl Gene ENSMUSG00000032480
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 30
SynonymsDdx30, 2810477H02Rik, C130058C04Rik
MMRRC Submission 040222-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R2220 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110084320-110117830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110087635 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 575 (L575P)
Ref Sequence ENSEMBL: ENSMUSP00000143371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035055] [ENSMUST00000062368] [ENSMUST00000111991] [ENSMUST00000163979] [ENSMUST00000164930] [ENSMUST00000165596] [ENSMUST00000165876] [ENSMUST00000196171] [ENSMUST00000197928] [ENSMUST00000198425] [ENSMUST00000199498] [ENSMUST00000199529] [ENSMUST00000199693] [ENSMUST00000200066]
Predicted Effect probably benign
Transcript: ENSMUST00000035055
SMART Domains Protein: ENSMUSP00000035055
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.96e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.96e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 903 926 2e-12 PFAM
Pfam:Tubulin-binding 965 995 4.9e-18 PFAM
Pfam:Tubulin-binding 996 1026 7.4e-18 PFAM
Pfam:Tubulin-binding 1027 1058 4.4e-15 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000062368
AA Change: L604P

PolyPhen 2 Score 0.674 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000062622
Gene: ENSMUSG00000032480
AA Change: L604P

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 48 64 N/A INTRINSIC
internal_repeat_1 76 123 2.53e-5 PROSPERO
low complexity region 217 228 N/A INTRINSIC
internal_repeat_1 268 314 2.53e-5 PROSPERO
low complexity region 321 342 N/A INTRINSIC
DEXDc 461 650 9.66e-29 SMART
low complexity region 679 689 N/A INTRINSIC
HELICc 711 816 1.63e-17 SMART
HA2 879 969 5.16e-22 SMART
Pfam:OB_NTP_bind 984 1134 5.7e-9 PFAM
low complexity region 1200 1208 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111991
AA Change: L575P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107622
Gene: ENSMUSG00000032480
AA Change: L575P

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163979
SMART Domains Protein: ENSMUSP00000129362
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 5.8e-16 PFAM
Pfam:Tubulin-binding 774 804 2.2e-18 PFAM
Pfam:Tubulin-binding 805 836 1.6e-11 PFAM
low complexity region 871 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164930
SMART Domains Protein: ENSMUSP00000131285
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 6e-16 PFAM
Pfam:Tubulin-binding 774 804 4.5e-19 PFAM
Pfam:Tubulin-binding 805 835 2.3e-18 PFAM
Pfam:Tubulin-binding 836 867 1.6e-11 PFAM
low complexity region 902 917 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165596
AA Change: L598P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129174
Gene: ENSMUSG00000032480
AA Change: L598P

DomainStartEndE-ValueType
internal_repeat_1 70 117 6.77e-5 PROSPERO
low complexity region 211 222 N/A INTRINSIC
internal_repeat_1 262 308 6.77e-5 PROSPERO
low complexity region 315 336 N/A INTRINSIC
DEXDc 455 644 9.66e-29 SMART
low complexity region 673 683 N/A INTRINSIC
HELICc 705 810 1.63e-17 SMART
HA2 873 963 5.16e-22 SMART
Pfam:OB_NTP_bind 975 1129 1.8e-7 PFAM
low complexity region 1194 1202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165876
SMART Domains Protein: ENSMUSP00000132662
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.95e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.95e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 896 926 8.5e-16 PFAM
Pfam:Tubulin-binding 965 995 6.4e-19 PFAM
Pfam:Tubulin-binding 996 1026 3.3e-18 PFAM
Pfam:Tubulin-binding 1027 1058 2.3e-11 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196171
AA Change: L567P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143616
Gene: ENSMUSG00000032480
AA Change: L567P

DomainStartEndE-ValueType
internal_repeat_1 39 86 5.84e-5 PROSPERO
low complexity region 180 191 N/A INTRINSIC
internal_repeat_1 231 277 5.84e-5 PROSPERO
low complexity region 284 305 N/A INTRINSIC
DEXDc 424 613 9.66e-29 SMART
low complexity region 642 652 N/A INTRINSIC
HELICc 674 779 1.63e-17 SMART
HA2 842 932 5.16e-22 SMART
Pfam:OB_NTP_bind 947 1097 2.8e-9 PFAM
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196914
Predicted Effect probably damaging
Transcript: ENSMUST00000197928
AA Change: L575P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142549
Gene: ENSMUSG00000032480
AA Change: L575P

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198026
Predicted Effect probably damaging
Transcript: ENSMUST00000198425
AA Change: L598P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142659
Gene: ENSMUSG00000032480
AA Change: L598P

DomainStartEndE-ValueType
internal_repeat_1 70 117 6.77e-5 PROSPERO
low complexity region 211 222 N/A INTRINSIC
internal_repeat_1 262 308 6.77e-5 PROSPERO
low complexity region 315 336 N/A INTRINSIC
DEXDc 455 644 9.66e-29 SMART
low complexity region 673 683 N/A INTRINSIC
HELICc 705 810 1.63e-17 SMART
HA2 873 963 5.16e-22 SMART
Pfam:OB_NTP_bind 975 1129 1.8e-7 PFAM
low complexity region 1194 1202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199332
Predicted Effect probably benign
Transcript: ENSMUST00000199498
SMART Domains Protein: ENSMUSP00000142439
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 5.8e-16 PFAM
Pfam:Tubulin-binding 774 804 2.2e-18 PFAM
Pfam:Tubulin-binding 805 836 1.6e-11 PFAM
low complexity region 871 886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199529
AA Change: L575P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142489
Gene: ENSMUSG00000032480
AA Change: L575P

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200029
Predicted Effect probably damaging
Transcript: ENSMUST00000200066
AA Change: L575P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143371
Gene: ENSMUSG00000032480
AA Change: L575P

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200593
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The family member encoded by this gene is a mitochondrial nucleoid protein that associates with mitochondrial DNA. It has also been identified as a component of a transcriptional repressor complex that functions in retinal development, and it is required to optimize the function of the zinc-finger antiviral protein. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality associated with embryonic growth retardation, failure of initiation of embryo turning, and absence of organized somites and neural tube formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,875,530 probably null Het
Aadacl4 T C 4: 144,618,002 I116T probably damaging Het
Aatk G T 11: 120,012,177 F407L probably damaging Het
Abca8a A T 11: 110,026,855 L1586Q probably damaging Het
Aox2 A G 1: 58,349,130 probably null Het
Ap5m1 A G 14: 49,081,095 D420G probably damaging Het
Bcl6 A T 16: 23,972,632 L324* probably null Het
Bicc1 A G 10: 70,950,125 S396P probably damaging Het
Ccdc83 G A 7: 90,259,514 S4L probably damaging Het
Cdkal1 T A 13: 29,354,758 M473L probably benign Het
Cep85 T C 4: 134,153,867 H363R probably damaging Het
Cfap61 G A 2: 146,036,816 probably null Het
Cfap65 T C 1: 74,904,025 I1614V probably damaging Het
Cluh T A 11: 74,667,121 F1062I probably damaging Het
Cntnap5a A T 1: 116,580,639 T1294S possibly damaging Het
Cops8 A C 1: 90,606,619 N94T probably benign Het
Csmd1 T C 8: 15,992,641 D2364G possibly damaging Het
Cyb5d1 T C 11: 69,395,045 D55G probably benign Het
Cyp2c29 A T 19: 39,287,232 I39F probably benign Het
Cyp2j8 T C 4: 96,444,625 S495G probably benign Het
Dnah7a C T 1: 53,521,174 V2113I probably benign Het
Dusp3 T C 11: 101,974,805 N95D probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam208b A T 13: 3,581,872 N876K probably benign Het
Fer1l4 T G 2: 156,031,764 Y1207S probably damaging Het
Flg2 T G 3: 93,202,185 S507A unknown Het
Gdf6 A G 4: 9,844,770 H98R probably damaging Het
Ggnbp2 T C 11: 84,836,613 N63S possibly damaging Het
Ggt7 A G 2: 155,495,719 S504P probably damaging Het
Gm14548 A T 7: 3,897,489 N87K probably benign Het
Gtf2h5 G A 17: 6,084,578 E48K probably benign Het
Hivep3 T G 4: 119,734,038 V81G possibly damaging Het
Igsf21 A G 4: 140,028,114 M410T probably damaging Het
Insrr T C 3: 87,809,418 L651P probably damaging Het
Iqcb1 A T 16: 36,843,462 probably null Het
Klhdc7a G A 4: 139,965,453 R728C probably benign Het
Lars2 T C 9: 123,418,780 L334P probably damaging Het
Mast3 T C 8: 70,780,963 E994G probably damaging Het
Mertk T A 2: 128,801,472 N930K probably benign Het
Mettl21a A T 1: 64,616,283 V46E probably damaging Het
Nedd4 T A 9: 72,736,707 C614S probably damaging Het
Olfr168 A T 16: 19,530,145 Y258* probably null Het
Olfr173 G T 16: 58,797,624 A74D possibly damaging Het
Olfr525 T C 7: 140,323,571 S291P probably benign Het
Pard3b C T 1: 62,479,683 R976* probably null Het
Pcdhb16 A G 18: 37,478,967 T327A probably benign Het
Ppp1r37 C A 7: 19,532,446 R465L probably null Het
Ppp3ca C A 3: 136,797,924 T86K probably damaging Het
Ralgapa2 G A 2: 146,421,679 T706I probably benign Het
Rnf213 T C 11: 119,436,428 L1747P possibly damaging Het
Slc11a1 T A 1: 74,380,665 F166I probably damaging Het
Slc25a18 G A 6: 120,793,557 probably null Het
Stt3a A G 9: 36,749,551 probably null Het
Supt16 G A 14: 52,172,144 R770* probably null Het
Syde2 A G 3: 146,001,958 I551V probably benign Het
Tecta T C 9: 42,392,030 D102G probably damaging Het
Tmc7 A T 7: 118,552,816 I294N possibly damaging Het
Tmem174 T C 13: 98,637,259 Y21C probably damaging Het
Tomm40l A T 1: 171,221,981 L13* probably null Het
Trim30c A G 7: 104,383,267 V284A probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Uggt2 A T 14: 119,075,337 N353K probably damaging Het
Vps13d C T 4: 145,178,320 V79M probably damaging Het
Wfdc18 C T 11: 83,709,913 R45* probably null Het
Other mutations in Dhx30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Dhx30 APN 9 110086245 missense probably benign 0.01
IGL01800:Dhx30 APN 9 110085513 missense possibly damaging 0.92
IGL02403:Dhx30 APN 9 110091519 missense probably damaging 1.00
IGL02869:Dhx30 APN 9 110097183 missense probably damaging 1.00
IGL03177:Dhx30 APN 9 110088010 missense possibly damaging 0.75
R0092:Dhx30 UTSW 9 110085010 missense possibly damaging 0.94
R0601:Dhx30 UTSW 9 110086714 unclassified probably null
R1667:Dhx30 UTSW 9 110085445 missense possibly damaging 0.91
R1667:Dhx30 UTSW 9 110085446 missense possibly damaging 0.48
R1670:Dhx30 UTSW 9 110085273 missense possibly damaging 0.86
R1728:Dhx30 UTSW 9 110098751 missense probably damaging 0.98
R1729:Dhx30 UTSW 9 110098751 missense probably damaging 0.98
R1795:Dhx30 UTSW 9 110107983 splice site probably null
R1854:Dhx30 UTSW 9 110088672 missense probably damaging 1.00
R2191:Dhx30 UTSW 9 110086118 critical splice donor site probably null
R2219:Dhx30 UTSW 9 110087635 missense probably damaging 1.00
R2267:Dhx30 UTSW 9 110087034 missense probably damaging 1.00
R2374:Dhx30 UTSW 9 110091564 missense probably damaging 0.98
R2568:Dhx30 UTSW 9 110097195 missense probably damaging 0.99
R2881:Dhx30 UTSW 9 110098845 nonsense probably null
R4022:Dhx30 UTSW 9 110084397 missense possibly damaging 0.90
R4052:Dhx30 UTSW 9 110100821 missense possibly damaging 0.46
R4695:Dhx30 UTSW 9 110085288 missense probably damaging 0.98
R4728:Dhx30 UTSW 9 110087650 missense probably damaging 1.00
R4892:Dhx30 UTSW 9 110085856 unclassified probably null
R4911:Dhx30 UTSW 9 110100924 missense probably damaging 1.00
R4937:Dhx30 UTSW 9 110085961 missense probably damaging 1.00
R5135:Dhx30 UTSW 9 110098795 missense probably damaging 1.00
R5359:Dhx30 UTSW 9 110093135 missense probably damaging 0.99
R5462:Dhx30 UTSW 9 110100974 missense probably damaging 0.97
R5504:Dhx30 UTSW 9 110085210 missense probably benign 0.08
R5797:Dhx30 UTSW 9 110098820 missense probably damaging 0.99
R5860:Dhx30 UTSW 9 110084577 missense probably damaging 0.98
R6041:Dhx30 UTSW 9 110084598 missense probably benign 0.09
R6132:Dhx30 UTSW 9 110085779 missense probably damaging 1.00
R6158:Dhx30 UTSW 9 110087030 missense probably damaging 1.00
R6475:Dhx30 UTSW 9 110085052 missense possibly damaging 0.91
R6818:Dhx30 UTSW 9 110088031 missense probably damaging 1.00
R6984:Dhx30 UTSW 9 110091417 critical splice donor site probably null
X0027:Dhx30 UTSW 9 110084434 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AAGGAAAGCTCCAGACCCTG -3'
(R):5'- TACGCTTGGAAAGTAAGCCCC -3'

Sequencing Primer
(F):5'- GGGTACTGATGTTTACCCAGC -3'
(R):5'- TTGGAAAGTAAGCCCCCAGCC -3'
Posted On2014-10-15