Incidental Mutation 'R2220:Cluh'
ID241440
Institutional Source Beutler Lab
Gene Symbol Cluh
Ensembl Gene ENSMUSG00000020741
Gene Nameclustered mitochondria (cluA/CLU1) homolog
Synonyms1300001I01Rik
MMRRC Submission 040222-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.565) question?
Stock #R2220 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location74649495-74670847 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74667121 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1062 (F1062I)
Ref Sequence ENSEMBL: ENSMUSP00000113371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092915] [ENSMUST00000117818]
Predicted Effect probably damaging
Transcript: ENSMUST00000092915
AA Change: F1113I

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090593
Gene: ENSMUSG00000020741
AA Change: F1113I

DomainStartEndE-ValueType
Pfam:CLU_N 104 177 3.1e-28 PFAM
Pfam:CLU 394 614 3.4e-89 PFAM
Pfam:eIF3_p135 806 988 1.3e-58 PFAM
Pfam:TPR_10 1059 1100 2.9e-7 PFAM
low complexity region 1114 1125 N/A INTRINSIC
Pfam:TPR_12 1140 1218 1.7e-10 PFAM
low complexity region 1316 1334 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117818
AA Change: F1062I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113371
Gene: ENSMUSG00000020741
AA Change: F1062I

DomainStartEndE-ValueType
Pfam:CLU_N 102 177 9.8e-30 PFAM
Pfam:CLU 394 615 5.3e-92 PFAM
Pfam:eIF3_p135 796 938 2.9e-38 PFAM
Pfam:TPR_10 1008 1049 9.5e-7 PFAM
low complexity region 1063 1074 N/A INTRINSIC
Pfam:TPR_12 1089 1167 1.1e-9 PFAM
low complexity region 1265 1283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155558
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Constitutive homozygous KO affects liver mitochondrial function and leads to neonatal lethality. Conditional homozygous KO in the adult liver affects cellular respiration under energy stress conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,875,530 probably null Het
Aadacl4 T C 4: 144,618,002 I116T probably damaging Het
Aatk G T 11: 120,012,177 F407L probably damaging Het
Abca8a A T 11: 110,026,855 L1586Q probably damaging Het
Aox2 A G 1: 58,349,130 probably null Het
Ap5m1 A G 14: 49,081,095 D420G probably damaging Het
Bcl6 A T 16: 23,972,632 L324* probably null Het
Bicc1 A G 10: 70,950,125 S396P probably damaging Het
Ccdc83 G A 7: 90,259,514 S4L probably damaging Het
Cdkal1 T A 13: 29,354,758 M473L probably benign Het
Cep85 T C 4: 134,153,867 H363R probably damaging Het
Cfap61 G A 2: 146,036,816 probably null Het
Cfap65 T C 1: 74,904,025 I1614V probably damaging Het
Cntnap5a A T 1: 116,580,639 T1294S possibly damaging Het
Cops8 A C 1: 90,606,619 N94T probably benign Het
Csmd1 T C 8: 15,992,641 D2364G possibly damaging Het
Cyb5d1 T C 11: 69,395,045 D55G probably benign Het
Cyp2c29 A T 19: 39,287,232 I39F probably benign Het
Cyp2j8 T C 4: 96,444,625 S495G probably benign Het
Dhx30 A G 9: 110,087,635 L575P probably damaging Het
Dnah7a C T 1: 53,521,174 V2113I probably benign Het
Dusp3 T C 11: 101,974,805 N95D probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam208b A T 13: 3,581,872 N876K probably benign Het
Fer1l4 T G 2: 156,031,764 Y1207S probably damaging Het
Flg2 T G 3: 93,202,185 S507A unknown Het
Gdf6 A G 4: 9,844,770 H98R probably damaging Het
Ggnbp2 T C 11: 84,836,613 N63S possibly damaging Het
Ggt7 A G 2: 155,495,719 S504P probably damaging Het
Gm14548 A T 7: 3,897,489 N87K probably benign Het
Gtf2h5 G A 17: 6,084,578 E48K probably benign Het
Hivep3 T G 4: 119,734,038 V81G possibly damaging Het
Igsf21 A G 4: 140,028,114 M410T probably damaging Het
Insrr T C 3: 87,809,418 L651P probably damaging Het
Iqcb1 A T 16: 36,843,462 probably null Het
Klhdc7a G A 4: 139,965,453 R728C probably benign Het
Lars2 T C 9: 123,418,780 L334P probably damaging Het
Mast3 T C 8: 70,780,963 E994G probably damaging Het
Mertk T A 2: 128,801,472 N930K probably benign Het
Mettl21a A T 1: 64,616,283 V46E probably damaging Het
Nedd4 T A 9: 72,736,707 C614S probably damaging Het
Olfr168 A T 16: 19,530,145 Y258* probably null Het
Olfr173 G T 16: 58,797,624 A74D possibly damaging Het
Olfr525 T C 7: 140,323,571 S291P probably benign Het
Pard3b C T 1: 62,479,683 R976* probably null Het
Pcdhb16 A G 18: 37,478,967 T327A probably benign Het
Ppp1r37 C A 7: 19,532,446 R465L probably null Het
Ppp3ca C A 3: 136,797,924 T86K probably damaging Het
Ralgapa2 G A 2: 146,421,679 T706I probably benign Het
Rnf213 T C 11: 119,436,428 L1747P possibly damaging Het
Slc11a1 T A 1: 74,380,665 F166I probably damaging Het
Slc25a18 G A 6: 120,793,557 probably null Het
Stt3a A G 9: 36,749,551 probably null Het
Supt16 G A 14: 52,172,144 R770* probably null Het
Syde2 A G 3: 146,001,958 I551V probably benign Het
Tecta T C 9: 42,392,030 D102G probably damaging Het
Tmc7 A T 7: 118,552,816 I294N possibly damaging Het
Tmem174 T C 13: 98,637,259 Y21C probably damaging Het
Tomm40l A T 1: 171,221,981 L13* probably null Het
Trim30c A G 7: 104,383,267 V284A probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Uggt2 A T 14: 119,075,337 N353K probably damaging Het
Vps13d C T 4: 145,178,320 V79M probably damaging Het
Wfdc18 C T 11: 83,709,913 R45* probably null Het
Other mutations in Cluh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cluh APN 11 74664064 missense probably benign 0.28
IGL00858:Cluh APN 11 74659605 missense possibly damaging 0.86
IGL01380:Cluh APN 11 74665946 missense probably benign 0.04
IGL02402:Cluh APN 11 74657171 missense probably damaging 1.00
IGL02620:Cluh APN 11 74665067 nonsense probably null
IGL02990:Cluh APN 11 74667765 splice site probably null
IGL03163:Cluh APN 11 74666068 missense probably benign 0.44
IGL03208:Cluh APN 11 74669506 unclassified probably null
IGL03293:Cluh APN 11 74665752 missense probably benign 0.03
IGL03408:Cluh APN 11 74665953 missense probably benign 0.06
spent UTSW 11 74660372 missense probably damaging 1.00
FR4342:Cluh UTSW 11 74669524 small insertion probably benign
FR4342:Cluh UTSW 11 74669526 small insertion probably benign
FR4449:Cluh UTSW 11 74669532 small insertion probably benign
FR4589:Cluh UTSW 11 74669531 small insertion probably benign
FR4737:Cluh UTSW 11 74669514 small insertion probably benign
FR4737:Cluh UTSW 11 74669519 small insertion probably benign
FR4737:Cluh UTSW 11 74669524 small insertion probably benign
FR4737:Cluh UTSW 11 74669533 small insertion probably benign
FR4976:Cluh UTSW 11 74669520 small insertion probably benign
R0147:Cluh UTSW 11 74665938 missense probably damaging 1.00
R0153:Cluh UTSW 11 74657350 splice site probably benign
R0506:Cluh UTSW 11 74664894 missense probably benign 0.20
R0526:Cluh UTSW 11 74665986 missense probably benign 0.05
R0834:Cluh UTSW 11 74663805 missense probably benign 0.02
R1873:Cluh UTSW 11 74662076 missense possibly damaging 0.72
R1991:Cluh UTSW 11 74659529 nonsense probably null
R1992:Cluh UTSW 11 74660002 missense probably damaging 1.00
R2095:Cluh UTSW 11 74661724 nonsense probably null
R2101:Cluh UTSW 11 74660502 splice site probably benign
R2103:Cluh UTSW 11 74659529 nonsense probably null
R3702:Cluh UTSW 11 74665356 missense probably benign
R3853:Cluh UTSW 11 74656453 missense probably benign 0.00
R3900:Cluh UTSW 11 74667104 missense probably benign 0.29
R4891:Cluh UTSW 11 74665059 missense possibly damaging 0.51
R4895:Cluh UTSW 11 74667405 missense probably damaging 1.00
R5056:Cluh UTSW 11 74661946 missense probably damaging 1.00
R5089:Cluh UTSW 11 74660372 missense probably damaging 1.00
R5217:Cluh UTSW 11 74659705 missense probably damaging 1.00
R5346:Cluh UTSW 11 74665218 missense probably damaging 1.00
R5382:Cluh UTSW 11 74665109 intron probably benign
R5516:Cluh UTSW 11 74660444 missense probably damaging 1.00
R5809:Cluh UTSW 11 74661700 missense probably damaging 1.00
R6146:Cluh UTSW 11 74667228 splice site probably null
R6326:Cluh UTSW 11 74666242 missense probably benign 0.10
R6541:Cluh UTSW 11 74657214 missense probably damaging 1.00
R6674:Cluh UTSW 11 74666227 missense probably damaging 1.00
R6870:Cluh UTSW 11 74665384 missense probably damaging 1.00
R6875:Cluh UTSW 11 74661918 missense probably damaging 1.00
X0028:Cluh UTSW 11 74663466 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ATCAACAGAAGGCCGTGCTG -3'
(R):5'- TCCATTACTCCATGCAGCAC -3'

Sequencing Primer
(F):5'- CCGTGCTGATGAGTGAGC -3'
(R):5'- ACCAGCCCGATGTTGTTCTGG -3'
Posted On2014-10-15