Incidental Mutation 'R2220:Espl1'
ID241456
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Nameextra spindle pole bodies 1, separase
SynonymsSSE, ESP1, PRCE, Cerp, PRCE, separase
MMRRC Submission 040222-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2220 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102296266-102324357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102312989 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 944 (I944V)
Ref Sequence ENSEMBL: ENSMUSP00000155304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
Predicted Effect probably damaging
Transcript: ENSMUST00000064924
AA Change: I944V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: I944V

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229050
AA Change: I944V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230120
Meta Mutation Damage Score 0.212 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,875,530 probably null Het
Aadacl4 T C 4: 144,618,002 I116T probably damaging Het
Aatk G T 11: 120,012,177 F407L probably damaging Het
Abca8a A T 11: 110,026,855 L1586Q probably damaging Het
Aox2 A G 1: 58,349,130 probably null Het
Ap5m1 A G 14: 49,081,095 D420G probably damaging Het
Bcl6 A T 16: 23,972,632 L324* probably null Het
Bicc1 A G 10: 70,950,125 S396P probably damaging Het
Ccdc83 G A 7: 90,259,514 S4L probably damaging Het
Cdkal1 T A 13: 29,354,758 M473L probably benign Het
Cep85 T C 4: 134,153,867 H363R probably damaging Het
Cfap61 G A 2: 146,036,816 probably null Het
Cfap65 T C 1: 74,904,025 I1614V probably damaging Het
Cluh T A 11: 74,667,121 F1062I probably damaging Het
Cntnap5a A T 1: 116,580,639 T1294S possibly damaging Het
Cops8 A C 1: 90,606,619 N94T probably benign Het
Csmd1 T C 8: 15,992,641 D2364G possibly damaging Het
Cyb5d1 T C 11: 69,395,045 D55G probably benign Het
Cyp2c29 A T 19: 39,287,232 I39F probably benign Het
Cyp2j8 T C 4: 96,444,625 S495G probably benign Het
Dhx30 A G 9: 110,087,635 L575P probably damaging Het
Dnah7a C T 1: 53,521,174 V2113I probably benign Het
Dusp3 T C 11: 101,974,805 N95D probably damaging Het
Fam208b A T 13: 3,581,872 N876K probably benign Het
Fer1l4 T G 2: 156,031,764 Y1207S probably damaging Het
Flg2 T G 3: 93,202,185 S507A unknown Het
Gdf6 A G 4: 9,844,770 H98R probably damaging Het
Ggnbp2 T C 11: 84,836,613 N63S possibly damaging Het
Ggt7 A G 2: 155,495,719 S504P probably damaging Het
Gm14548 A T 7: 3,897,489 N87K probably benign Het
Gtf2h5 G A 17: 6,084,578 E48K probably benign Het
Hivep3 T G 4: 119,734,038 V81G possibly damaging Het
Igsf21 A G 4: 140,028,114 M410T probably damaging Het
Insrr T C 3: 87,809,418 L651P probably damaging Het
Iqcb1 A T 16: 36,843,462 probably null Het
Klhdc7a G A 4: 139,965,453 R728C probably benign Het
Lars2 T C 9: 123,418,780 L334P probably damaging Het
Mast3 T C 8: 70,780,963 E994G probably damaging Het
Mertk T A 2: 128,801,472 N930K probably benign Het
Mettl21a A T 1: 64,616,283 V46E probably damaging Het
Nedd4 T A 9: 72,736,707 C614S probably damaging Het
Olfr168 A T 16: 19,530,145 Y258* probably null Het
Olfr173 G T 16: 58,797,624 A74D possibly damaging Het
Olfr525 T C 7: 140,323,571 S291P probably benign Het
Pard3b C T 1: 62,479,683 R976* probably null Het
Pcdhb16 A G 18: 37,478,967 T327A probably benign Het
Ppp1r37 C A 7: 19,532,446 R465L probably null Het
Ppp3ca C A 3: 136,797,924 T86K probably damaging Het
Ralgapa2 G A 2: 146,421,679 T706I probably benign Het
Rnf213 T C 11: 119,436,428 L1747P possibly damaging Het
Slc11a1 T A 1: 74,380,665 F166I probably damaging Het
Slc25a18 G A 6: 120,793,557 probably null Het
Stt3a A G 9: 36,749,551 probably null Het
Supt16 G A 14: 52,172,144 R770* probably null Het
Syde2 A G 3: 146,001,958 I551V probably benign Het
Tecta T C 9: 42,392,030 D102G probably damaging Het
Tmc7 A T 7: 118,552,816 I294N possibly damaging Het
Tmem174 T C 13: 98,637,259 Y21C probably damaging Het
Tomm40l A T 1: 171,221,981 L13* probably null Het
Trim30c A G 7: 104,383,267 V284A probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Uggt2 A T 14: 119,075,337 N353K probably damaging Het
Vps13d C T 4: 145,178,320 V79M probably damaging Het
Wfdc18 C T 11: 83,709,913 R45* probably null Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102299813 missense probably damaging 1.00
IGL00839:Espl1 APN 15 102320547 unclassified probably benign
IGL00919:Espl1 APN 15 102298629 missense probably benign 0.03
IGL01125:Espl1 APN 15 102322938 missense probably damaging 1.00
IGL01366:Espl1 APN 15 102319836 missense probably benign 0.00
IGL01488:Espl1 APN 15 102298739 missense probably benign
IGL01554:Espl1 APN 15 102313225 missense probably damaging 1.00
IGL01810:Espl1 APN 15 102298205 missense probably benign
IGL01959:Espl1 APN 15 102305662 splice site probably benign
IGL02267:Espl1 APN 15 102315664 missense probably benign 0.01
IGL02452:Espl1 APN 15 102299839 missense probably damaging 1.00
IGL02469:Espl1 APN 15 102314025 missense probably damaging 1.00
IGL02500:Espl1 APN 15 102315800 missense probably benign
IGL02630:Espl1 APN 15 102296818 missense probably benign 0.11
IGL02687:Espl1 APN 15 102313178 splice site probably benign
IGL02868:Espl1 APN 15 102313990 nonsense probably null
IGL02926:Espl1 APN 15 102299855 missense probably damaging 0.99
R0019:Espl1 UTSW 15 102306319 missense probably null 0.01
R0129:Espl1 UTSW 15 102316648 missense probably benign 0.00
R0184:Espl1 UTSW 15 102299216 missense probably benign 0.01
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0267:Espl1 UTSW 15 102313017 missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102303986 nonsense probably null
R0587:Espl1 UTSW 15 102303947 splice site probably benign
R0726:Espl1 UTSW 15 102322598 missense probably benign
R1186:Espl1 UTSW 15 102304039 missense probably benign 0.05
R1282:Espl1 UTSW 15 102315391 missense probably benign 0.00
R1428:Espl1 UTSW 15 102305685 missense probably benign 0.06
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1473:Espl1 UTSW 15 102320443 missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102298367 missense probably damaging 0.98
R1639:Espl1 UTSW 15 102320714 missense probably damaging 1.00
R1725:Espl1 UTSW 15 102313221 missense probably benign 0.08
R1748:Espl1 UTSW 15 102298529 missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102299013 missense probably benign
R1938:Espl1 UTSW 15 102305042 missense probably benign 0.00
R1954:Espl1 UTSW 15 102298388 missense probably damaging 1.00
R2009:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2014:Espl1 UTSW 15 102322714 nonsense probably null
R2067:Espl1 UTSW 15 102299090 missense probably damaging 0.96
R2084:Espl1 UTSW 15 102296851 critical splice donor site probably null
R2164:Espl1 UTSW 15 102319588 missense probably damaging 1.00
R2204:Espl1 UTSW 15 102305905 missense probably damaging 1.00
R2237:Espl1 UTSW 15 102315569 missense probably damaging 0.98
R2314:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3107:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3108:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3114:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3616:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3733:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3958:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3959:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3960:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4062:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4063:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4064:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4165:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4166:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4349:Espl1 UTSW 15 102319604 missense probably benign 0.26
R4373:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4376:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4377:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4516:Espl1 UTSW 15 102323236 missense probably benign 0.00
R4595:Espl1 UTSW 15 102298724 missense probably benign 0.01
R4884:Espl1 UTSW 15 102324070 missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102322323 critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102315241 missense probably damaging 0.98
R4931:Espl1 UTSW 15 102305730 missense probably benign 0.02
R4936:Espl1 UTSW 15 102304937 missense probably damaging 1.00
R5000:Espl1 UTSW 15 102298551 missense probably damaging 1.00
R5220:Espl1 UTSW 15 102298577 missense probably benign 0.03
R5329:Espl1 UTSW 15 102312518 missense probably damaging 0.97
R5501:Espl1 UTSW 15 102317130 missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102324030 missense probably damaging 1.00
R5848:Espl1 UTSW 15 102322576 missense probably benign 0.03
R5906:Espl1 UTSW 15 102296851 critical splice donor site probably null
R5978:Espl1 UTSW 15 102315774 missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102299888 missense probably damaging 0.99
R6313:Espl1 UTSW 15 102315812 missense probably benign 0.00
R6414:Espl1 UTSW 15 102315560 missense probably damaging 0.96
R6484:Espl1 UTSW 15 102323500 missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102299225 missense probably benign
R6928:Espl1 UTSW 15 102298907 missense probably benign 0.28
X0062:Espl1 UTSW 15 102298397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAGAGGGAAAGAGCTCTGTGTTC -3'
(R):5'- TGCACCAGATTCTCACCTGC -3'

Sequencing Primer
(F):5'- GGAAAGAGCTCTGTGTTCAATTAG -3'
(R):5'- CTGCGGTGAATGAAAGACAGACATC -3'
Posted On2014-10-15