Incidental Mutation 'R0166:Impa1'
ID24149
Institutional Source Beutler Lab
Gene Symbol Impa1
Ensembl Gene ENSMUSG00000027531
Gene Nameinositol (myo)-1(or 4)-monophosphatase 1
Synonymslithium-sensitive myo-inositol monophosphatase A1, 2900059K10Rik, 2610002K09Rik
MMRRC Submission 038442-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R0166 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location10311956-10331439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 10328960 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 16 (A16T)
Ref Sequence ENSEMBL: ENSMUSP00000068174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065938] [ENSMUST00000078748] [ENSMUST00000118410] [ENSMUST00000128912] [ENSMUST00000191670] [ENSMUST00000192603]
Predicted Effect probably benign
Transcript: ENSMUST00000065938
AA Change: A16T

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068174
Gene: ENSMUSG00000027531
AA Change: A16T

DomainStartEndE-ValueType
Pfam:Inositol_P 5 271 1.5e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078748
SMART Domains Protein: ENSMUSP00000077808
Gene: ENSMUSG00000058921

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:SBF 144 328 1.1e-34 PFAM
transmembrane domain 336 358 N/A INTRINSIC
transmembrane domain 365 384 N/A INTRINSIC
transmembrane domain 394 416 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118410
AA Change: A16T

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113860
Gene: ENSMUSG00000027531
AA Change: A16T

DomainStartEndE-ValueType
Pfam:Inositol_P 5 271 7.7e-79 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128912
AA Change: A30T

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116088
Gene: ENSMUSG00000027531
AA Change: A30T

DomainStartEndE-ValueType
Pfam:Inositol_P 19 90 4.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191670
AA Change: A16T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141345
Gene: ENSMUSG00000027531
AA Change: A16T

DomainStartEndE-ValueType
Pfam:Inositol_P 5 180 4.7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192603
SMART Domains Protein: ENSMUSP00000141735
Gene: ENSMUSG00000103392

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Meta Mutation Damage Score 0.304 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that dephosphorylates myo-inositol monophosphate to generate free myo-inositol, a precursor of phosphatidylinositol, and is therefore an important modulator of intracellular signal transduction via the production of the second messengers myoinositol 1,4,5-trisphosphate and diacylglycerol. This enzyme can also use myo-inositol-1,3-diphosphate, myo-inositol-1,4-diphosphate, scyllo-inositol-phosphate, glucose-1-phosphate, glucose-6-phosphate, fructose-1-phosphate, beta-glycerophosphate, and 2'-AMP as substrates. This enzyme shows magnesium-dependent phosphatase activity and is inhibited by therapeutic concentrations of lithium. Inhibition of inositol monophosphate hydroylosis and subsequent depletion of inositol for phosphatidylinositol synthesis may explain the anti-manic and anti-depressive effects of lithium administered to treat bipolar disorder. Alternative splicing results in multiple transcript variants encoding distinct isoforms. A pseudogene of this gene is also present on chromosome 8q21.13. [provided by RefSeq, Dec 2014]
PHENOTYPE: Most mice homozygous for a knock-out allele die between E9.5 and E10.5 with surviving mice exhibiting hyperactivity, increased rearing, and increased susceptibility to pilocarpine-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,853,468 F1040L probably damaging Het
Adamts7 A G 9: 90,193,692 N1201S probably benign Het
Ahnak C T 19: 9,005,725 P1458S probably damaging Het
Akap6 T C 12: 53,140,924 V1707A probably benign Het
Akr1c21 T A 13: 4,581,264 V266E probably damaging Het
Arap2 A C 5: 62,676,018 C894G probably damaging Het
Atp2a2 T C 5: 122,466,838 D426G possibly damaging Het
Azi2 A T 9: 118,055,841 Q132L possibly damaging Het
Carmil1 C T 13: 24,099,049 D501N probably damaging Het
Cnot7 A T 8: 40,507,453 probably null Het
Cntnap5b A G 1: 100,274,361 E311G probably benign Het
Csmd1 A G 8: 16,233,022 V640A probably benign Het
Cst7 T C 2: 150,575,727 S31P probably benign Het
Cyp7b1 T A 3: 18,097,366 I228L probably benign Het
Ddx28 G A 8: 106,010,289 T379I probably benign Het
Dirc2 G A 16: 35,719,314 T379I possibly damaging Het
Drd1 T A 13: 54,053,581 I205F probably damaging Het
Flnb T A 14: 7,896,115 V837D probably damaging Het
Fsd1l A G 4: 53,647,664 probably null Het
Fubp1 T A 3: 152,220,204 Y284* probably null Het
Gbp5 T A 3: 142,506,919 probably null Het
Gm13088 T A 4: 143,654,511 H314L probably benign Het
Gm7094 A G 1: 21,272,734 noncoding transcript Het
Gpr55 A G 1: 85,941,136 V241A probably benign Het
Llgl2 T C 11: 115,844,854 L92P probably damaging Het
Ltbp2 T A 12: 84,786,358 Q1492L probably benign Het
Lyplal1 A T 1: 186,088,746 M168K probably benign Het
Macc1 A T 12: 119,447,080 R528* probably null Het
Mdm1 T A 10: 118,166,680 D680E probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mrpl23 C T 7: 142,535,114 R69W probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nr0b2 A G 4: 133,553,738 Q105R probably damaging Het
Olfr920 T A 9: 38,756,188 S167T probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Pcdhb14 A T 18: 37,448,489 D216V probably null Het
Plxna1 A G 6: 89,333,019 W1055R probably damaging Het
Prdm1 C T 10: 44,440,091 R716Q probably damaging Het
Proser1 C A 3: 53,480,617 Q909K possibly damaging Het
Pus10 T A 11: 23,667,358 C24S probably damaging Het
Rpl27 T A 11: 101,445,320 F69I possibly damaging Het
Sctr A T 1: 120,055,394 I325F probably damaging Het
Slc5a3 G A 16: 92,077,693 V213I possibly damaging Het
Spib G T 7: 44,529,900 D45E probably damaging Het
Spic T C 10: 88,675,717 S226G possibly damaging Het
Tet1 T A 10: 62,840,279 T673S probably benign Het
Tph1 A G 7: 46,647,596 F392L probably damaging Het
Ttc28 T C 5: 111,225,634 S979P probably benign Het
Unc79 T C 12: 103,156,553 L2110P probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Zfp467 T C 6: 48,438,681 T346A probably benign Het
Other mutations in Impa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Impa1 APN 3 10322948 missense probably damaging 1.00
IGL02411:Impa1 APN 3 10322958 missense possibly damaging 0.90
IGL02733:Impa1 APN 3 10328965 missense probably benign
IGL03183:Impa1 APN 3 10322994 missense probably damaging 1.00
lofty UTSW 3 10329004 missense probably null 1.00
R0782:Impa1 UTSW 3 10322896 splice site probably benign
R1645:Impa1 UTSW 3 10328441 missense possibly damaging 0.79
R3196:Impa1 UTSW 3 10329015 splice site probably null
R3905:Impa1 UTSW 3 10316034 missense probably benign
R4953:Impa1 UTSW 3 10315280 missense probably damaging 1.00
R5495:Impa1 UTSW 3 10326170 missense probably benign 0.08
R5884:Impa1 UTSW 3 10316224 missense probably damaging 1.00
R5972:Impa1 UTSW 3 10329004 missense probably null 1.00
X0054:Impa1 UTSW 3 10316100 splice site probably null
Predicted Primers PCR Primer
(F):5'- CACACAGGAAATCAGCCATTTTCACTG -3'
(R):5'- GTCACTTGGGAGACAGCTTCATAGAAC -3'

Sequencing Primer
(F):5'- AAATCAGCCATTTTCACTGTATTTAC -3'
(R):5'- acagacggggtcaggag -3'
Posted On2013-04-16