Incidental Mutation 'R2221:Gm5174'
ID241507
Institutional Source Beutler Lab
Gene Symbol Gm5174
Ensembl Gene ENSMUSG00000090308
Gene Namepredicted gene 5174
Synonyms
MMRRC Submission 040223-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R2221 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location86655939-86657381 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 86656508 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171131
SMART Domains Protein: ENSMUSP00000129952
Gene: ENSMUSG00000090308

DomainStartEndE-ValueType
S_TKc 14 262 5.59e-86 SMART
UBA 276 313 1.28e-3 SMART
low complexity region 447 462 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219608
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik A T 7: 131,247,457 probably null Het
Adamtsl1 A C 4: 86,388,525 D1392A probably benign Het
Afdn T C 17: 13,883,737 probably benign Het
Aph1b A T 9: 66,784,639 M121K probably damaging Het
Aspg G A 12: 112,114,434 A120T probably damaging Het
Bicd1 A G 6: 149,517,005 T725A probably damaging Het
Cd1d2 A T 3: 86,988,540 I292F probably damaging Het
Cdk13 A G 13: 17,719,535 V495A probably damaging Het
Cfd A T 10: 79,892,205 probably null Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cradd A C 10: 95,175,873 V135G probably benign Het
Cry1 A G 10: 85,143,753 C460R probably damaging Het
Ctu2 A G 8: 122,480,910 E375G probably damaging Het
Dym T G 18: 75,230,165 I580S probably damaging Het
Eif3e A G 15: 43,251,547 L411P possibly damaging Het
Emsy T C 7: 98,590,775 E1091G possibly damaging Het
Enkur A G 2: 21,189,319 probably benign Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Frem2 G A 3: 53,516,857 A3053V probably benign Het
Gbgt1 T C 2: 28,498,423 L40P probably damaging Het
Gys2 G T 6: 142,456,422 D230E probably damaging Het
Herc2 T A 7: 56,169,018 probably null Het
Hps3 A T 3: 20,002,363 S815R probably benign Het
Igf1r C A 7: 68,201,962 S983R probably damaging Het
Itsn1 T A 16: 91,853,768 probably benign Het
Kcnc2 A G 10: 112,456,526 N91D probably damaging Het
Kif28 C A 1: 179,733,111 A210S possibly damaging Het
Klri2 T A 6: 129,740,309 Q37L probably damaging Het
Lrrc38 T A 4: 143,369,849 C243* probably null Het
Map3k5 T C 10: 20,067,920 V590A possibly damaging Het
Mdn1 C A 4: 32,763,306 F5135L probably benign Het
Megf11 G A 9: 64,660,431 G401S possibly damaging Het
Mst1r T C 9: 107,908,348 F402L probably damaging Het
Ntrk3 T C 7: 78,198,852 I759V probably damaging Het
Nup188 T C 2: 30,336,924 probably benign Het
Olfr1243 C T 2: 89,527,937 V158I probably benign Het
Olfr870 T C 9: 20,171,092 S160G possibly damaging Het
Prdm2 T C 4: 143,134,899 N607S possibly damaging Het
Prl2a1 T A 13: 27,806,386 probably null Het
Serpina9 T A 12: 103,998,264 I305F probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc19a1 C T 10: 77,042,486 T285I probably benign Het
Snap91 T C 9: 86,792,527 T544A possibly damaging Het
Srgap3 A G 6: 112,946,493 S2P probably damaging Het
Tcof1 A G 18: 60,837,901 V210A possibly damaging Het
Tex261 A G 6: 83,771,515 I136T probably benign Het
Trpa1 A T 1: 14,903,256 F279L probably null Het
Ttc39b T C 4: 83,232,762 N532S probably benign Het
Ttn T C 2: 76,742,094 T26152A probably damaging Het
Ube2w A G 1: 16,597,959 S97P possibly damaging Het
Vmn1r25 A C 6: 57,979,238 L22R probably damaging Het
Vmn1r64 T C 7: 5,884,449 I32V probably benign Het
Vmn2r112 T G 17: 22,601,233 M29R possibly damaging Het
Vmn2r71 T A 7: 85,624,093 M705K probably benign Het
Vps13b G A 15: 35,884,597 V3139I probably benign Het
Zfp628 T C 7: 4,920,831 V684A probably benign Het
Other mutations in Gm5174
AlleleSourceChrCoordTypePredicted EffectPPH Score
Laco UTSW 10 86656108 unclassified noncoding transcript
R1083:Gm5174 UTSW 10 86656108 unclassified noncoding transcript
R1199:Gm5174 UTSW 10 86657325 unclassified noncoding transcript
R1296:Gm5174 UTSW 10 86657002 unclassified noncoding transcript
R1715:Gm5174 UTSW 10 86656912 unclassified noncoding transcript
R1957:Gm5174 UTSW 10 86656753 unclassified noncoding transcript
R2223:Gm5174 UTSW 10 86656508 unclassified noncoding transcript
R3104:Gm5174 UTSW 10 86656655 unclassified noncoding transcript
R4165:Gm5174 UTSW 10 86656933 unclassified noncoding transcript
R4166:Gm5174 UTSW 10 86656933 unclassified noncoding transcript
R4243:Gm5174 UTSW 10 86656280 unclassified noncoding transcript
R4244:Gm5174 UTSW 10 86656280 unclassified noncoding transcript
R5024:Gm5174 UTSW 10 86656587 unclassified noncoding transcript
R5292:Gm5174 UTSW 10 86656698 unclassified noncoding transcript
R5586:Gm5174 UTSW 10 86656545 unclassified noncoding transcript
R5864:Gm5174 UTSW 10 86657181 unclassified noncoding transcript
Predicted Primers PCR Primer
(F):5'- CCTCTGTCAAGTATTGTCACAAC -3'
(R):5'- AATGGATGGCCTCTTCTCAGG -3'

Sequencing Primer
(F):5'- GTCACAACCTTAATATTGTCCATCG -3'
(R):5'- CCTCTTCTCAGGGGGAACTGTG -3'
Posted On2014-10-15