Incidental Mutation 'R2223:5430419D17Rik'
ID241616
Institutional Source Beutler Lab
Gene Symbol 5430419D17Rik
Ensembl Gene ENSMUSG00000006204
Gene NameRIKEN cDNA 5430419D17 gene
Synonyms
MMRRC Submission 040224-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2223 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location131174402-131306451 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 131247457 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050586] [ENSMUST00000124096] [ENSMUST00000208921]
Predicted Effect probably null
Transcript: ENSMUST00000050586
SMART Domains Protein: ENSMUSP00000061529
Gene: ENSMUSG00000006204

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 85 105 N/A INTRINSIC
SR 144 244 3.3e-57 SMART
CUB 272 378 1.2e-16 SMART
SR 428 528 3.9e-56 SMART
low complexity region 533 548 N/A INTRINSIC
CUB 556 667 5.1e-38 SMART
SR 680 780 1.5e-57 SMART
Pfam:CUB 795 840 3.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000208921
Meta Mutation Damage Score 0.6124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 A G 3: 40,934,861 probably benign Het
Acvr1b C T 15: 101,203,043 A362V probably benign Het
Adamts5 A C 16: 85,899,306 L321R probably damaging Het
Adamtsl1 A C 4: 86,388,525 D1392A probably benign Het
Afdn T C 17: 13,883,737 probably benign Het
Aph1b A T 9: 66,784,639 M121K probably damaging Het
Aspg G A 12: 112,114,434 A120T probably damaging Het
Atp8b1 T A 18: 64,564,357 N472I possibly damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cfd A T 10: 79,892,205 probably null Het
Cntnap5b A G 1: 100,213,687 E242G probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cradd A C 10: 95,175,873 V135G probably benign Het
Cry1 A G 10: 85,143,753 C460R probably damaging Het
Cryz A T 3: 154,618,554 N192I possibly damaging Het
Cyp2d11 T A 15: 82,390,131 M350L probably benign Het
Emsy T C 7: 98,590,775 E1091G possibly damaging Het
Exoc3l4 C G 12: 111,426,152 A471G possibly damaging Het
Fam184a G A 10: 53,655,079 T733M probably damaging Het
Fmo2 C T 1: 162,898,244 C21Y probably damaging Het
Glul T A 1: 153,906,497 probably null Het
Gm5174 T A 10: 86,656,508 noncoding transcript Het
Gtpbp2 A G 17: 46,167,227 I434V probably benign Het
Kctd10 G T 5: 114,367,349 R195S probably benign Het
Lrrc38 T A 4: 143,369,849 C243* probably null Het
Luc7l2 T C 6: 38,565,724 probably benign Het
Magi2 T A 5: 20,465,672 V111D probably damaging Het
Map3k5 T C 10: 20,067,920 V590A possibly damaging Het
Megf11 G A 9: 64,660,431 G401S possibly damaging Het
Mgat4d G A 8: 83,355,672 probably benign Het
Mroh1 T C 15: 76,408,045 probably null Het
Mx1 T C 16: 97,455,232 probably benign Het
Nlrp1b A G 11: 71,155,989 probably benign Het
Ntrk3 T C 7: 78,198,852 I759V probably damaging Het
Olfr800 T A 10: 129,659,809 M1K probably null Het
Pde8b T C 13: 95,043,447 N318S probably damaging Het
Pkd1l1 T C 11: 8,889,063 T874A probably benign Het
Pkd1l1 T C 11: 8,950,422 T40A probably benign Het
Prdm2 T C 4: 143,134,899 N607S possibly damaging Het
Ptprn A T 1: 75,257,937 probably benign Het
Setx T G 2: 29,148,537 I1678S possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Snap91 T C 9: 86,792,527 T544A possibly damaging Het
Sp8 G A 12: 118,849,738 G443S probably damaging Het
Stk39 C T 2: 68,314,579 G384S probably damaging Het
Sva T A 6: 42,038,423 M1K probably null Het
Trip10 A G 17: 57,263,039 D568G possibly damaging Het
Trpa1 A T 1: 14,903,256 F279L probably null Het
Ttc39b T C 4: 83,232,762 N532S probably benign Het
Ube2w A G 1: 16,597,959 S97P possibly damaging Het
Uvssa C T 5: 33,392,063 T356I probably damaging Het
Vmn1r25 A C 6: 57,979,238 L22R probably damaging Het
Vmn2r112 T G 17: 22,601,233 M29R possibly damaging Het
Vmn2r71 T A 7: 85,624,093 M705K probably benign Het
Zfp516 C A 18: 82,955,770 A31D possibly damaging Het
Other mutations in 5430419D17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:5430419D17Rik APN 7 131238094 unclassified probably null
IGL00848:5430419D17Rik APN 7 131246724 missense probably damaging 1.00
IGL00966:5430419D17Rik APN 7 131243107 nonsense probably null
IGL01286:5430419D17Rik APN 7 131246703 missense probably damaging 1.00
IGL01303:5430419D17Rik APN 7 131194331 missense possibly damaging 0.53
IGL01585:5430419D17Rik APN 7 131244758 missense probably damaging 0.97
IGL01665:5430419D17Rik APN 7 131246657 nonsense probably null
IGL01953:5430419D17Rik APN 7 131224980 missense probably benign 0.04
IGL02427:5430419D17Rik APN 7 131244788 missense probably damaging 0.99
IGL02508:5430419D17Rik APN 7 131222830 missense probably damaging 1.00
IGL02678:5430419D17Rik APN 7 131228917 missense probably damaging 1.00
IGL03092:5430419D17Rik APN 7 131201798 critical splice donor site probably null
IGL03122:5430419D17Rik APN 7 131196514 missense possibly damaging 0.68
IGL03343:5430419D17Rik APN 7 131246691 missense probably damaging 1.00
R0011:5430419D17Rik UTSW 7 131229993 missense probably damaging 0.99
R0011:5430419D17Rik UTSW 7 131229993 missense probably damaging 0.99
R0234:5430419D17Rik UTSW 7 131194303 splice site probably null
R0234:5430419D17Rik UTSW 7 131194303 splice site probably null
R0268:5430419D17Rik UTSW 7 131238176 missense probably damaging 1.00
R0383:5430419D17Rik UTSW 7 131239539 missense probably benign 0.05
R0973:5430419D17Rik UTSW 7 131238182 missense probably damaging 1.00
R0973:5430419D17Rik UTSW 7 131238182 missense probably damaging 1.00
R0974:5430419D17Rik UTSW 7 131238182 missense probably damaging 1.00
R1572:5430419D17Rik UTSW 7 131244831 nonsense probably null
R1911:5430419D17Rik UTSW 7 131238089 missense probably damaging 1.00
R2032:5430419D17Rik UTSW 7 131243052 missense probably damaging 1.00
R2097:5430419D17Rik UTSW 7 131181964 nonsense probably null
R2221:5430419D17Rik UTSW 7 131247457 critical splice acceptor site probably null
R2254:5430419D17Rik UTSW 7 131222905 missense probably damaging 1.00
R2913:5430419D17Rik UTSW 7 131182024 missense possibly damaging 0.90
R2991:5430419D17Rik UTSW 7 131246700 missense probably damaging 1.00
R3439:5430419D17Rik UTSW 7 131188779 critical splice donor site probably null
R4418:5430419D17Rik UTSW 7 131247465 missense possibly damaging 0.86
R4916:5430419D17Rik UTSW 7 131174477 synonymous probably null
R5488:5430419D17Rik UTSW 7 131246595 missense probably damaging 1.00
R5594:5430419D17Rik UTSW 7 131239523 missense probably benign 0.12
R5897:5430419D17Rik UTSW 7 131196551 splice site probably null
R5898:5430419D17Rik UTSW 7 131241967 splice site probably null
R5940:5430419D17Rik UTSW 7 131238263 missense probably damaging 1.00
R6170:5430419D17Rik UTSW 7 131174487 splice site probably null
R6187:5430419D17Rik UTSW 7 131270599 intron probably benign
R6321:5430419D17Rik UTSW 7 131257006 critical splice donor site probably null
R6409:5430419D17Rik UTSW 7 131262071 intron probably benign
R6432:5430419D17Rik UTSW 7 131244872 critical splice donor site probably null
R6481:5430419D17Rik UTSW 7 131256801 missense probably benign 0.05
R6750:5430419D17Rik UTSW 7 131288245 intron probably benign
R6783:5430419D17Rik UTSW 7 131226764 missense probably damaging 0.99
R6836:5430419D17Rik UTSW 7 131196504 missense possibly damaging 0.84
R6925:5430419D17Rik UTSW 7 131222707 missense possibly damaging 0.92
R6995:5430419D17Rik UTSW 7 131222671 missense probably damaging 1.00
R7199:5430419D17Rik UTSW 7 131235912 nonsense probably null
R7205:5430419D17Rik UTSW 7 131277623 critical splice donor site probably null
R7340:5430419D17Rik UTSW 7 131277615 missense unknown
R7354:5430419D17Rik UTSW 7 131256729 missense possibly damaging 0.84
R7354:5430419D17Rik UTSW 7 131272033 missense unknown
R7434:5430419D17Rik UTSW 7 131279483 missense unknown
R7485:5430419D17Rik UTSW 7 131228833 missense probably damaging 0.99
Z1088:5430419D17Rik UTSW 7 131246633 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAACACTCCTTTAGCAAG -3'
(R):5'- ACTATTCCTGGCAACTAGGGGTG -3'

Sequencing Primer
(F):5'- CCTTTAGCAAGAAAGGCAGGAAATAC -3'
(R):5'- TGGAGGTTCTAATGCAACCC -3'
Posted On2014-10-15