Incidental Mutation 'R2251:Gzf1'
ID241657
Institutional Source Beutler Lab
Gene Symbol Gzf1
Ensembl Gene ENSMUSG00000027439
Gene NameGDNF-inducible zinc finger protein 1
SynonymsZfp336, 8430437G08Rik
MMRRC Submission 040251-MU
Accession Numbers

Ncbi RefSeq: NM_028986.3; MGI:1921783

Is this an essential gene? Possibly essential (E-score: 0.702) question?
Stock #R2251 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location148681023-148692949 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148683936 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 109 (M109T)
Ref Sequence ENSEMBL: ENSMUSP00000028928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028928] [ENSMUST00000131292]
Predicted Effect probably damaging
Transcript: ENSMUST00000028928
AA Change: M109T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028928
Gene: ENSMUSG00000027439
AA Change: M109T

DomainStartEndE-ValueType
BTB 31 133 2.01e-20 SMART
low complexity region 199 213 N/A INTRINSIC
coiled coil region 287 308 N/A INTRINSIC
ZnF_C2H2 315 337 6.32e-3 SMART
ZnF_C2H2 346 369 1.2e-3 SMART
ZnF_C2H2 375 398 8.34e-3 SMART
ZnF_C2H2 405 427 7.78e-3 SMART
ZnF_C2H2 433 455 1.69e-3 SMART
ZnF_C2H2 461 483 1.43e-1 SMART
ZnF_C2H2 489 511 2.4e-3 SMART
ZnF_C2H2 517 539 1.47e-3 SMART
ZnF_C2H2 545 567 1.38e-3 SMART
ZnF_C2H2 573 595 1.04e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131292
AA Change: M109T

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121799
Gene: ENSMUSG00000027439
AA Change: M109T

DomainStartEndE-ValueType
BTB 31 133 2.01e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151362
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Abl1 T A 2: 31,779,119 V170E probably damaging Het
Akap13 C T 7: 75,739,477 T2381M possibly damaging Het
Armc8 T A 9: 99,502,600 probably null Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cntn2 T C 1: 132,525,321 E411G probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Fam186a T C 15: 99,945,097 T1089A probably benign Het
Fgb T G 3: 83,043,284 T388P probably damaging Het
Fndc1 G A 17: 7,753,607 R1498W probably damaging Het
Gch1 T C 14: 47,189,341 probably benign Het
H2-M10.1 A C 17: 36,325,606 L102R probably damaging Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
N4bp2 G A 5: 65,806,728 V707I probably damaging Het
Nav2 A G 7: 49,453,277 K608E probably damaging Het
Nfix T C 8: 84,716,170 D458G probably benign Het
Ngdn T C 14: 55,023,395 probably null Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr138 C T 17: 38,274,903 A44V probably benign Het
Olfr672 A T 7: 104,996,595 M103K probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pbld2 G T 10: 63,024,605 probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Pwp2 T A 10: 78,181,088 Q266L probably benign Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Scn8a A G 15: 101,017,106 I1184V probably benign Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Smim11 T C 16: 92,310,828 Y14H probably benign Het
Spata17 A T 1: 187,048,473 L359Q possibly damaging Het
Spn T C 7: 127,137,159 K59E probably benign Het
Tap2 A G 17: 34,211,954 S343G probably damaging Het
Tcp11l2 T C 10: 84,605,069 probably null Het
Tlr11 T A 14: 50,360,792 N78K probably benign Het
Tm9sf2 T A 14: 122,139,731 S224T probably benign Het
Trpm1 G A 7: 64,209,976 G261D probably damaging Het
Usp3 T C 9: 66,562,578 D87G probably damaging Het
Vmn1r189 T C 13: 22,102,548 K40E probably damaging Het
Vps45 A T 3: 96,057,040 D56E probably benign Het
Vstm2a C A 11: 16,368,273 Q231K probably benign Het
Zcchc11 T A 4: 108,520,208 D938E probably damaging Het
Zfp575 A T 7: 24,585,590 C209S probably damaging Het
Zfp768 T C 7: 127,344,378 T193A probably benign Het
Zfp867 T A 11: 59,465,493 R38* probably null Het
Other mutations in Gzf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Gzf1 APN 2 148690996 missense probably damaging 0.99
IGL01647:Gzf1 APN 2 148683650 missense probably damaging 1.00
IGL01789:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01791:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01952:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01954:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL01956:Gzf1 APN 2 148684061 missense probably benign 0.41
IGL03391:Gzf1 APN 2 148683683 missense probably damaging 1.00
I0000:Gzf1 UTSW 2 148686620 unclassified probably benign
P0019:Gzf1 UTSW 2 148683980 missense probably damaging 1.00
R0420:Gzf1 UTSW 2 148683833 missense probably benign 0.30
R0725:Gzf1 UTSW 2 148684649 nonsense probably null
R1131:Gzf1 UTSW 2 148690867 missense probably benign 0.02
R2000:Gzf1 UTSW 2 148684611 missense probably benign 0.16
R2211:Gzf1 UTSW 2 148684950 missense probably damaging 1.00
R2252:Gzf1 UTSW 2 148683936 missense probably damaging 1.00
R2253:Gzf1 UTSW 2 148683936 missense probably damaging 1.00
R4233:Gzf1 UTSW 2 148686533 missense possibly damaging 0.86
R5551:Gzf1 UTSW 2 148684328 missense probably damaging 1.00
R6050:Gzf1 UTSW 2 148684238 missense possibly damaging 0.89
R6891:Gzf1 UTSW 2 148684769 nonsense probably null
R7457:Gzf1 UTSW 2 148690082 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTCATGGCCCATAAAGCAGTG -3'
(R):5'- TACAAGGCCATTGGAGTGAG -3'

Sequencing Primer
(F):5'- CCATAAAGCAGTGCTGGCG -3'
(R):5'- ATTGGAGTGAGCATCCTCCC -3'
Posted On2014-10-16