Mutagenetix > Incidental Mutations

Incidental Mutation 'R2251:Nfix'

241680

Institutional Source

Beutler Lab

Gene Symbol

Nfix

Ensembl Gene

ENSMUSG00000001911

Gene Name

nuclear factor I/X

Synonyms

MMRRC Submission

040251-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.330) question?

Stock #

R2251 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84699876-84800344 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84716170 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 458 (D458G)

Ref Sequence

ENSEMBL: ENSMUSP00000115691 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076715] [ENSMUST00000099070] [ENSMUST00000109762] [ENSMUST00000109764] [ENSMUST00000126806]

Predicted Effect

probably benign
Transcript: ENSMUST00000076715

SMART Domains

Protein: ENSMUSP00000076005
Gene: ENSMUSG00000001911

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	3	46	4.1e-30	PFAM
DWA	67	175	1.86e-18	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:CTF_NFI	213	322	7.4e-32	PFAM
Pfam:CTF_NFI	313	396	3.8e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000099070

SMART Domains

Protein: ENSMUSP00000096669
Gene: ENSMUSG00000001911

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	3	46	4.7e-30	PFAM
DWA	67	175	1.86e-18	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:CTF_NFI	213	437	2.7e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109762

SMART Domains

Protein: ENSMUSP00000105384
Gene: ENSMUSG00000001911

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	1	38	1.1e-27	PFAM
DWA	59	167	1.86e-18	SMART
low complexity region	180	191	N/A	INTRINSIC
Pfam:CTF_NFI	205	312	5.4e-32	PFAM
Pfam:CTF_NFI	305	387	3.6e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109764
AA Change: D450G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000105386
Gene: ENSMUSG00000001911
AA Change: D450G

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	1	38	1e-28	PFAM
DWA	59	167	1.86e-18	SMART
low complexity region	180	191	N/A	INTRINSIC
Pfam:CTF_NFI	205	494	9.8e-137	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000126806
AA Change: D458G

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000115691
Gene: ENSMUSG00000001911
AA Change: D458G

Domain	Start	End	E-Value	Type
Pfam:NfI_DNAbd_pre-N	3	46	7.1e-31	PFAM
DWA	67	175	1.86e-18	SMART
low complexity region	188	199	N/A	INTRINSIC
Pfam:CTF_NFI	213	488	1.5e-83	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132236

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a mutation in this gene display postnatal lethality, hydrocephalus, partial agenesis of the corpus callosum, deformation of the spine due to delayed vertebral body ossification, degeneration of intervertebral disks, decreased mineralization and impaired endochondral ossification. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700129C05Rik	G	A	14: 59,142,612	S79F	probably damaging	Het
Abl1	T	A	2: 31,779,119	V170E	probably damaging	Het
Akap13	C	T	7: 75,739,477	T2381M	possibly damaging	Het
Armc8	T	A	9: 99,502,600		probably null	Het
B3gnt3	A	T	8: 71,692,818	M302K	probably damaging	Het
Casp3	G	T	8: 46,637,955	W214L	probably damaging	Het
Cnot1	A	G	8: 95,763,186	V463A	probably benign	Het
Cntn2	T	C	1: 132,525,321	E411G	probably damaging	Het
Dgkg	A	T	16: 22,622,260	M1K	probably null	Het
Faap20	A	C	4: 155,250,553	E37A	possibly damaging	Het
Fam186a	T	C	15: 99,945,097	T1089A	probably benign	Het
Fgb	T	G	3: 83,043,284	T388P	probably damaging	Het
Fndc1	G	A	17: 7,753,607	R1498W	probably damaging	Het
Gch1	T	C	14: 47,189,341		probably benign	Het
Gzf1	T	C	2: 148,683,936	M109T	probably damaging	Het
H2-M10.1	A	C	17: 36,325,606	L102R	probably damaging	Het
Kpna1	T	C	16: 36,021,569	Y280H	possibly damaging	Het
Mbtps2	A	T	X: 157,559,033	F270L	probably benign	Het
Mrpl40	T	C	16: 18,875,375	H29R	probably benign	Het
N4bp2	G	A	5: 65,806,728	V707I	probably damaging	Het
Nav2	A	G	7: 49,453,277	K608E	probably damaging	Het
Ngdn	T	C	14: 55,023,395		probably null	Het
Nr3c1	G	T	18: 39,486,751	T161K	probably benign	Het
Olfr1279	A	G	2: 111,306,310	Y35C	probably damaging	Het
Olfr138	C	T	17: 38,274,903	A44V	probably benign	Het
Olfr672	A	T	7: 104,996,595	M103K	probably damaging	Het
Olfr988	A	G	2: 85,353,858	S23P	possibly damaging	Het
Pbld2	G	T	10: 63,024,605		probably benign	Het
Pkd1l2	T	C	8: 117,057,438	Y700C	probably damaging	Het
Plcb2	T	C	2: 118,723,765	N69S	probably benign	Het
Pwp2	T	A	10: 78,181,088	Q266L	probably benign	Het
Rnf133	T	C	6: 23,649,175	M252V	probably benign	Het
Scn8a	A	G	15: 101,017,106	I1184V	probably benign	Het
Slc7a2	T	C	8: 40,905,621	Y334H	probably benign	Het
Smim11	T	C	16: 92,310,828	Y14H	probably benign	Het
Spata17	A	T	1: 187,048,473	L359Q	possibly damaging	Het
Spn	T	C	7: 127,137,159	K59E	probably benign	Het
Tap2	A	G	17: 34,211,954	S343G	probably damaging	Het
Tcp11l2	T	C	10: 84,605,069		probably null	Het
Tlr11	T	A	14: 50,360,792	N78K	probably benign	Het
Tm9sf2	T	A	14: 122,139,731	S224T	probably benign	Het
Trpm1	G	A	7: 64,209,976	G261D	probably damaging	Het
Usp3	T	C	9: 66,562,578	D87G	probably damaging	Het
Vmn1r189	T	C	13: 22,102,548	K40E	probably damaging	Het
Vps45	A	T	3: 96,057,040	D56E	probably benign	Het
Vstm2a	C	A	11: 16,368,273	Q231K	probably benign	Het
Zcchc11	T	A	4: 108,520,208	D938E	probably damaging	Het
Zfp575	A	T	7: 24,585,590	C209S	probably damaging	Het
Zfp768	T	C	7: 127,344,378	T193A	probably benign	Het
Zfp867	T	A	11: 59,465,493	R38*	probably null	Het

Other mutations in Nfix

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00913:Nfix	APN	8	84726477	missense	probably damaging	0.99
IGL01919:Nfix	APN	8	84726474	missense	probably damaging	1.00
IGL01950:Nfix	APN	8	84713786	makesense	probably null
IGL02862:Nfix	APN	8	84713846	missense	probably benign	0.07
R0142:Nfix	UTSW	8	84721686	missense	probably damaging	1.00
R0309:Nfix	UTSW	8	84721774	missense	probably damaging	1.00
R0600:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0622:Nfix	UTSW	8	84726482	missense	probably damaging	0.99
R0628:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0882:Nfix	UTSW	8	84727925	missense	probably damaging	1.00
R0893:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0973:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0973:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0974:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R0975:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1014:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1015:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1162:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1241:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1381:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1513:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1521:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1618:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R1865:Nfix	UTSW	8	84772275	missense	possibly damaging	0.73
R1912:Nfix	UTSW	8	84721677	missense	probably damaging	1.00
R1974:Nfix	UTSW	8	84726526	missense	probably damaging	1.00
R2208:Nfix	UTSW	8	84716247	frame shift	probably null
R2268:Nfix	UTSW	8	84716247	frame shift	probably null
R2270:Nfix	UTSW	8	84716247	frame shift	probably null
R2272:Nfix	UTSW	8	84727175	missense	probably damaging	1.00
R2346:Nfix	UTSW	8	84716247	frame shift	probably null
R2350:Nfix	UTSW	8	84716247	frame shift	probably null
R2963:Nfix	UTSW	8	84716247	frame shift	probably null
R2983:Nfix	UTSW	8	84716247	frame shift	probably null
R3008:Nfix	UTSW	8	84716247	frame shift	probably null
R3727:Nfix	UTSW	8	84716247	frame shift	probably null
R3791:Nfix	UTSW	8	84716247	frame shift	probably null
R4163:Nfix	UTSW	8	84716247	frame shift	probably null
R4164:Nfix	UTSW	8	84716247	frame shift	probably null
R4201:Nfix	UTSW	8	84716247	frame shift	probably null
R4206:Nfix	UTSW	8	84716247	frame shift	probably null
R4609:Nfix	UTSW	8	84726490	missense	probably damaging	1.00
R4801:Nfix	UTSW	8	84716247	frame shift	probably null
R4802:Nfix	UTSW	8	84716247	frame shift	probably null
R4914:Nfix	UTSW	8	84771829	missense	probably benign	0.00
R4915:Nfix	UTSW	8	84771829	missense	probably benign	0.00
R4916:Nfix	UTSW	8	84771829	missense	probably benign	0.00
R4918:Nfix	UTSW	8	84771829	missense	probably benign	0.00
R5013:Nfix	UTSW	8	84772084	missense	possibly damaging	0.86
R5290:Nfix	UTSW	8	84713777	nonsense	probably null
R6418:Nfix	UTSW	8	84727149	missense	probably benign	0.01
R6554:Nfix	UTSW	8	84727650	missense	possibly damaging	0.93
R6786:Nfix	UTSW	8	84727647	missense	probably damaging	1.00
T0970:Nfix	UTSW	8	84726483	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- TGCTGGCTGGAGTAACTGAG -3'
(R):5'- CTGTGCCTAGAGGAAAGGAC -3'

Sequencing Primer
(F):5'- TGGAGTAACTGAGGCCCC -3'
(R):5'- ATCTTCCATTGGGAGCGC -3'

Posted On

2014-10-16