Incidental Mutation 'R0166:Tph1'
ID24170
Institutional Source Beutler Lab
Gene Symbol Tph1
Ensembl Gene ENSMUSG00000040046
Gene Nametryptophan hydroxylase 1
Synonyms
MMRRC Submission 038442-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R0166 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location46644641-46672537 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46647596 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 392 (F392L)
Ref Sequence ENSEMBL: ENSMUSP00000103296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049298] [ENSMUST00000107669] [ENSMUST00000170251]
Predicted Effect probably damaging
Transcript: ENSMUST00000049298
AA Change: F392L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037752
Gene: ENSMUSG00000040046
AA Change: F392L

DomainStartEndE-ValueType
Pfam:ACT 21 87 4.3e-8 PFAM
Pfam:Biopterin_H 109 440 4.7e-188 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107669
AA Change: F392L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103296
Gene: ENSMUSG00000040046
AA Change: F392L

DomainStartEndE-ValueType
Pfam:Biopterin_H 109 439 7.6e-176 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110264
Predicted Effect probably benign
Transcript: ENSMUST00000170251
SMART Domains Protein: ENSMUSP00000132489
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:ACT 21 87 6.7e-8 PFAM
Pfam:Biopterin_H 109 279 3e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172386
SMART Domains Protein: ENSMUSP00000128727
Gene: ENSMUSG00000040046

DomainStartEndE-ValueType
Pfam:ACT 17 82 6.9e-9 PFAM
Pfam:Biopterin_H 105 164 8.9e-24 PFAM
low complexity region 175 188 N/A INTRINSIC
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: This gene encodes a member of the biopterin-dependent aromatic amino acid hydroxylase family. The encoded protein is one of two tryptophan hydroxylase enzymes that catalyze the first and rate limiting step in the biosynthesis of the hormone and neurotransmitter, serotonin. This gene is expressed in peripheral organs, while tryptophan hydroxylase 2 is expressed in neurons. The encoded protein is involved in the development of hypoxia-induced elevations in pulmonary pressures and pulmonary vascular remodeling, and has also been implicated as a regulator of immune tolerance. Disruption of this gene is associated with cardiac dysfunction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for one null allele display no gross behavioral abnormalities. Mice homozygous for a second null allele display fatigue, breathing difficulties, progressive pallor, and impaired cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,853,468 F1040L probably damaging Het
Adamts7 A G 9: 90,193,692 N1201S probably benign Het
Ahnak C T 19: 9,005,725 P1458S probably damaging Het
Akap6 T C 12: 53,140,924 V1707A probably benign Het
Akr1c21 T A 13: 4,581,264 V266E probably damaging Het
Arap2 A C 5: 62,676,018 C894G probably damaging Het
Atp2a2 T C 5: 122,466,838 D426G possibly damaging Het
Azi2 A T 9: 118,055,841 Q132L possibly damaging Het
Carmil1 C T 13: 24,099,049 D91N probably damaging Het
Cnot7 A T 8: 40,507,453 probably null Het
Cntnap5b A G 1: 100,274,361 E311G probably benign Het
Csmd1 A G 8: 16,233,022 V640A probably benign Het
Cst7 T C 2: 150,575,727 S31P probably benign Het
Cyp7b1 T A 3: 18,097,366 I228L probably benign Het
Ddx28 G A 8: 106,010,289 T379I probably benign Het
Dirc2 G A 16: 35,719,314 T379I possibly damaging Het
Drd1 T A 13: 54,053,581 I205F probably damaging Het
Flnb T A 14: 7,896,115 V837D probably damaging Het
Fsd1l A G 4: 53,647,664 probably null Het
Fubp1 T A 3: 152,220,204 Y264* probably null Het
Gbp5 T A 3: 142,506,919 probably null Het
Gm13088 T A 4: 143,654,511 H314L probably benign Het
Gm7094 A G 1: 21,272,734 noncoding transcript Het
Gpr55 A G 1: 85,941,136 V241A probably benign Het
Impa1 C T 3: 10,328,960 A16T probably damaging Het
Llgl2 T C 11: 115,844,854 L92P probably damaging Het
Ltbp2 T A 12: 84,786,358 Q1472L probably benign Het
Lyplal1 A T 1: 186,088,746 M168K probably benign Het
Macc1 A T 12: 119,447,080 R528* probably null Het
Mdm1 T A 10: 118,166,680 D635E probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mrpl23 C T 7: 142,535,114 R69W probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nr0b2 A G 4: 133,553,738 Q105R probably damaging Het
Olfr920 T A 9: 38,756,188 S167T probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Pcdhb14 A T 18: 37,448,489 probably null Het
Plxna1 A G 6: 89,333,019 W1055R probably damaging Het
Prdm1 C T 10: 44,440,091 R716Q probably damaging Het
Proser1 C A 3: 53,480,617 Q909K possibly damaging Het
Pus10 T A 11: 23,667,358 C24S probably damaging Het
Rpl27 T A 11: 101,445,320 F69I possibly damaging Het
Sctr A T 1: 120,055,394 I325F probably damaging Het
Slc5a3 G A 16: 92,077,693 V213I possibly damaging Het
Spib G T 7: 44,529,900 D28E probably damaging Het
Spic T C 10: 88,675,717 S226G possibly damaging Het
Tet1 T A 10: 62,840,279 T673S probably benign Het
Ttc28 T C 5: 111,225,634 S979P probably benign Het
Unc79 T C 12: 103,156,553 L2110P probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Zfp467 T C 6: 48,438,681 T346A probably benign Het
Other mutations in Tph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Tph1 APN 7 46656870 missense probably benign 0.02
IGL01318:Tph1 APN 7 46665238 missense probably damaging 0.99
IGL01538:Tph1 APN 7 46653753 missense probably damaging 1.00
IGL01564:Tph1 APN 7 46650881 splice site probably benign
IGL02021:Tph1 APN 7 46656997 missense possibly damaging 0.55
IGL02202:Tph1 APN 7 46653761 missense probably benign 0.40
IGL03072:Tph1 APN 7 46652859 missense probably damaging 0.99
I1329:Tph1 UTSW 7 46650013 missense probably damaging 0.99
R0433:Tph1 UTSW 7 46653821 missense probably damaging 1.00
R0485:Tph1 UTSW 7 46650024 missense probably benign 0.00
R0501:Tph1 UTSW 7 46649988 nonsense probably null
R1456:Tph1 UTSW 7 46647483 nonsense probably null
R1474:Tph1 UTSW 7 46653862 missense probably benign 0.00
R1846:Tph1 UTSW 7 46660439 missense probably damaging 0.98
R1967:Tph1 UTSW 7 46662114 missense probably benign 0.30
R2102:Tph1 UTSW 7 46660410 splice site probably null
R2176:Tph1 UTSW 7 46662039 missense possibly damaging 0.91
R2225:Tph1 UTSW 7 46665174 critical splice donor site probably null
R4773:Tph1 UTSW 7 46656952 missense probably damaging 1.00
R4914:Tph1 UTSW 7 46653859 missense probably damaging 1.00
R5590:Tph1 UTSW 7 46653792 missense probably damaging 1.00
R5622:Tph1 UTSW 7 46647545 nonsense probably null
R5960:Tph1 UTSW 7 46662005 critical splice donor site probably null
R5985:Tph1 UTSW 7 46653781 missense probably damaging 1.00
R6362:Tph1 UTSW 7 46647443 missense possibly damaging 0.94
R7151:Tph1 UTSW 7 46662117 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACTAGCCCTGGCTCTAGACTGATG -3'
(R):5'- GTTAACGCCCAGTATGGGAGGATG -3'

Sequencing Primer
(F):5'- TGGCTCTAGACTGATGCTCAAAG -3'
(R):5'- aagggaggagggaaaggg -3'
Posted On2013-04-16