Incidental Mutation 'R2252:Casp3'
ID241748
Institutional Source Beutler Lab
Gene Symbol Casp3
Ensembl Gene ENSMUSG00000031628
Gene Namecaspase 3
Synonymsmldy, Yama, Caspase-3, Apopain, CPP32, A830040C14Rik, CC3, AC-3
MMRRC Submission 040252-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2252 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location46617291-46639689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 46637955 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 214 (W214L)
Ref Sequence ENSEMBL: ENSMUSP00000147767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093517] [ENSMUST00000210534] [ENSMUST00000211115]
Predicted Effect probably damaging
Transcript: ENSMUST00000093517
AA Change: W214L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091238
Gene: ENSMUSG00000031628
AA Change: W214L

DomainStartEndE-ValueType
CASc 36 277 9.95e-143 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209668
Predicted Effect probably benign
Transcript: ENSMUST00000210534
Predicted Effect probably damaging
Transcript: ENSMUST00000211115
AA Change: W214L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that belongs to a highly conserved family of cysteinyl aspartate-specific proteases that function as essential regulators of programmed cell death through apoptosis. Members of this family contain an N-terminal pro-domain and require cleavage at specific aspartate residues to become mature. The protein encoded by this gene belongs to a subgroup of cysteinyl aspartate-specific proteases that are activated by initiator caspases and that perform the proteolytic cleavage of apoptotic target proteins. Mice defective for this gene exhibit a variety of phenotypes including reduced neuronal apoptosis resulting in hyperplasias, hearing loss, attenuated osteogenic differentiation of bone marrow stromal stem cells, and pre- and post-natal lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Some homozygous animals show defects in brain development by embryonic day 12, reduced neuronal apoptosis causing hyperplasias, and pre- and postnatal lethality. Other homozygous animals exhibit only hearing loss, inner ear defects and degeneration of spiral ganglion neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acaca G T 11: 84,371,532 V1987L probably damaging Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
BC048507 T C 13: 67,863,507 M1T probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Cd180 A T 13: 102,706,398 K651* probably null Het
Cdh15 T A 8: 122,857,422 D87E probably damaging Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cspg4 C T 9: 56,898,046 T2047I probably damaging Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Cwc27 A T 13: 104,631,729 H419Q probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Dock5 A T 14: 67,784,812 L1171H probably damaging Het
Drc1 G T 5: 30,342,731 V103F probably benign Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Foxa2 A G 2: 148,044,166 F243S probably damaging Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
L1td1 A G 4: 98,737,637 probably null Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Lrrc52 A T 1: 167,466,368 I116N probably damaging Het
Mbd5 A G 2: 49,257,686 E636G probably damaging Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
Nrip1 T C 16: 76,291,285 Y1128C probably damaging Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr143 A G 9: 38,253,830 I135V probably benign Het
Olfr958 G T 9: 39,549,977 A298D probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pard3 A T 8: 127,610,599 E1232V probably damaging Het
Pcif1 A G 2: 164,890,879 E628G probably benign Het
Pcsk1 C A 13: 75,126,726 A478D probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Pknox2 T C 9: 36,910,520 N270D probably benign Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Reep1 T A 6: 71,756,442 probably null Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A G 11: 87,589,811 N405D possibly damaging Het
Serpinb3b T C 1: 107,155,478 I231M possibly damaging Het
Serping1 A G 2: 84,769,851 S322P probably damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spink5 G T 18: 44,020,824 E1013* probably null Het
Thoc3 A T 13: 54,467,833 N139K probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tubb2b T A 13: 34,130,215 I7F possibly damaging Het
Upf2 A G 2: 5,961,460 D297G unknown Het
Vmn2r18 T C 5: 151,584,976 I228V possibly damaging Het
Vmn2r98 A C 17: 19,080,436 S567R probably benign Het
Vwa5a T C 9: 38,728,080 I369T probably damaging Het
Yjefn3 A C 8: 69,889,445 F42V probably damaging Het
Zfp472 A T 17: 32,976,283 R69* probably null Het
Zfp536 T C 7: 37,479,389 S200G probably benign Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Casp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Casp3 APN 8 46629741 utr 5 prime probably benign
warner UTSW 8 46635388 missense probably damaging 1.00
R0601:Casp3 UTSW 8 46636227 missense probably benign 0.00
R1541:Casp3 UTSW 8 46634334 missense probably benign 0.02
R1648:Casp3 UTSW 8 46638074 missense probably benign
R2046:Casp3 UTSW 8 46629726 splice site probably benign
R2159:Casp3 UTSW 8 46634288 missense probably damaging 1.00
R2176:Casp3 UTSW 8 46629756 missense probably damaging 1.00
R2251:Casp3 UTSW 8 46637955 missense probably damaging 0.98
R2253:Casp3 UTSW 8 46637955 missense probably damaging 0.98
R4095:Casp3 UTSW 8 46634216 missense probably damaging 1.00
R4209:Casp3 UTSW 8 46635388 missense probably damaging 1.00
R4211:Casp3 UTSW 8 46635388 missense probably damaging 1.00
R4868:Casp3 UTSW 8 46634279 missense probably benign 0.01
R5713:Casp3 UTSW 8 46636314 missense probably damaging 1.00
R6847:Casp3 UTSW 8 46636266 missense probably benign 0.00
R6957:Casp3 UTSW 8 46634273 missense probably damaging 1.00
R7196:Casp3 UTSW 8 46635463 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GCGTTTTCTTTTCCAGCAGAGAG -3'
(R):5'- TTCGTGAGCATGGACACAATAC -3'

Sequencing Primer
(F):5'- AGCAGTGAGGTCTGGAGTCC -3'
(R):5'- GGACACAATACACGGGATCTGTTTC -3'
Posted On2014-10-16