Incidental Mutation 'R2252:Tns2'
ID241775
Institutional Source Beutler Lab
Gene Symbol Tns2
Ensembl Gene ENSMUSG00000037003
Gene Nametensin 2
Synonymsnph, nep, Tenc1
MMRRC Submission 040252-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2252 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102100413-102116401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102108934 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 281 (R281C)
Ref Sequence ENSEMBL: ENSMUSP00000155830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046144] [ENSMUST00000169627] [ENSMUST00000228958] [ENSMUST00000229592] [ENSMUST00000230474]
Predicted Effect probably damaging
Transcript: ENSMUST00000046144
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041087
Gene: ENSMUSG00000037003
AA Change: R281C

DomainStartEndE-ValueType
C1 32 79 2.78e-9 SMART
SCOP:d1d5ra2 128 295 8e-24 SMART
PTEN_C2 297 424 6.63e-40 SMART
low complexity region 494 513 N/A INTRINSIC
SH2 1136 1236 1.69e-16 SMART
PTB 1269 1407 6.66e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169627
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129146
Gene: ENSMUSG00000037003
AA Change: R281C

DomainStartEndE-ValueType
C1 32 79 2.78e-9 SMART
SCOP:d1d5ra2 128 295 8e-24 SMART
PTEN_C2 297 424 6.63e-40 SMART
low complexity region 494 513 N/A INTRINSIC
SH2 1129 1229 1.69e-16 SMART
PTB 1262 1400 6.66e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228958
AA Change: R281C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229035
Predicted Effect probably benign
Transcript: ENSMUST00000229592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229908
Predicted Effect probably damaging
Transcript: ENSMUST00000230474
AA Change: R273C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.344 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype Strain: 2447990
Lethality: D70-D210
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tensin family. Tensin is a focal adhesion molecule that binds to actin filaments and participates in signaling pathways. This protein plays a role in regulating cell migration. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Affected mice homozygous for a spontaneous deletion show reduced female fertility, increased blood urea nitrogen, low hematocrit, proteinuria, hypoproteinemia, hypercholesterolemia, small kidneys with a yellowish granular surface, glomerular lesions and premature death; some develop systemic edema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acaca G T 11: 84,371,532 V1987L probably damaging Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
BC048507 T C 13: 67,863,507 M1T probably null Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd180 A T 13: 102,706,398 K651* probably null Het
Cdh15 T A 8: 122,857,422 D87E probably damaging Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cspg4 C T 9: 56,898,046 T2047I probably damaging Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Cwc27 A T 13: 104,631,729 H419Q probably damaging Het
Dgkg A T 16: 22,622,260 M1K probably null Het
Dock5 A T 14: 67,784,812 L1171H probably damaging Het
Drc1 G T 5: 30,342,731 V103F probably benign Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Faap20 A C 4: 155,250,553 E37A possibly damaging Het
Foxa2 A G 2: 148,044,166 F243S probably damaging Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kpna1 T C 16: 36,021,569 Y280H possibly damaging Het
L1td1 A G 4: 98,737,637 probably null Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Lrrc52 A T 1: 167,466,368 I116N probably damaging Het
Mbd5 A G 2: 49,257,686 E636G probably damaging Het
Mrpl40 T C 16: 18,875,375 H29R probably benign Het
Nrip1 T C 16: 76,291,285 Y1128C probably damaging Het
Olfr1279 A G 2: 111,306,310 Y35C probably damaging Het
Olfr143 A G 9: 38,253,830 I135V probably benign Het
Olfr958 G T 9: 39,549,977 A298D probably damaging Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pard3 A T 8: 127,610,599 E1232V probably damaging Het
Pcif1 A G 2: 164,890,879 E628G probably benign Het
Pcsk1 C A 13: 75,126,726 A478D probably benign Het
Pkd1l2 T C 8: 117,057,438 Y700C probably damaging Het
Pknox2 T C 9: 36,910,520 N270D probably benign Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Reep1 T A 6: 71,756,442 probably null Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sept4 A G 11: 87,589,811 N405D possibly damaging Het
Serpinb3b T C 1: 107,155,478 I231M possibly damaging Het
Serping1 A G 2: 84,769,851 S322P probably damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spink5 G T 18: 44,020,824 E1013* probably null Het
Thoc3 A T 13: 54,467,833 N139K probably benign Het
Tubb2b T A 13: 34,130,215 I7F possibly damaging Het
Upf2 A G 2: 5,961,460 D297G unknown Het
Vmn2r18 T C 5: 151,584,976 I228V possibly damaging Het
Vmn2r98 A C 17: 19,080,436 S567R probably benign Het
Vwa5a T C 9: 38,728,080 I369T probably damaging Het
Yjefn3 A C 8: 69,889,445 F42V probably damaging Het
Zfp472 A T 17: 32,976,283 R69* probably null Het
Zfp536 T C 7: 37,479,389 S200G probably benign Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Tns2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Tns2 APN 15 102113191 missense probably damaging 1.00
IGL01935:Tns2 APN 15 102111634 unclassified probably null
IGL01994:Tns2 APN 15 102111379 missense possibly damaging 0.81
IGL02025:Tns2 APN 15 102112049 nonsense probably null
IGL02135:Tns2 APN 15 102113026 missense probably damaging 1.00
IGL02355:Tns2 APN 15 102112290 missense probably benign
IGL02362:Tns2 APN 15 102112290 missense probably benign
IGL02439:Tns2 APN 15 102114543 missense probably damaging 1.00
IGL02488:Tns2 APN 15 102112743 missense probably benign
IGL02546:Tns2 APN 15 102110940 missense probably damaging 1.00
IGL02616:Tns2 APN 15 102111415 missense probably benign
IGL02628:Tns2 APN 15 102111828 missense probably benign 0.04
IGL02658:Tns2 APN 15 102107796 splice site probably benign
IGL03267:Tns2 APN 15 102105378 critical splice donor site probably null
P0005:Tns2 UTSW 15 102114056 missense probably damaging 0.98
R0586:Tns2 UTSW 15 102109585 splice site probably benign
R0791:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0817:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0818:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0819:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R0820:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1451:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1452:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1453:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1454:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1455:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1487:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1510:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1579:Tns2 UTSW 15 102111210 missense probably damaging 1.00
R1698:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1772:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1779:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1843:Tns2 UTSW 15 102113133 unclassified probably null
R1923:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1924:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1927:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R1980:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2051:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2087:Tns2 UTSW 15 102107119 missense possibly damaging 0.70
R2100:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2103:Tns2 UTSW 15 102112665 critical splice acceptor site probably null
R2105:Tns2 UTSW 15 102107506 missense probably benign 0.27
R2224:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2225:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2227:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2253:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2290:Tns2 UTSW 15 102112023 missense probably damaging 0.99
R2304:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2318:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2446:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2447:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2448:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2566:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2567:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2897:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R2898:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3159:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3160:Tns2 UTSW 15 102113336 missense possibly damaging 0.88
R3162:Tns2 UTSW 15 102113336 missense possibly damaging 0.88
R3162:Tns2 UTSW 15 102113336 missense possibly damaging 0.88
R3196:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3237:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3426:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3427:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3428:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3695:Tns2 UTSW 15 102112749 missense probably null
R3767:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R3911:Tns2 UTSW 15 102113837 critical splice donor site probably null
R4113:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4157:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4394:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4395:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4396:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4439:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4441:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4537:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4538:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4541:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4599:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4600:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4602:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4773:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4774:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4775:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4776:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R4880:Tns2 UTSW 15 102112039 missense probably damaging 0.98
R4989:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5014:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5058:Tns2 UTSW 15 102107860 missense possibly damaging 0.68
R5253:Tns2 UTSW 15 102111453 missense probably damaging 1.00
R5336:Tns2 UTSW 15 102111229 missense probably damaging 1.00
R5351:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5452:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5453:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5629:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5630:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5631:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R5685:Tns2 UTSW 15 102107103 missense probably benign 0.02
R5844:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6048:Tns2 UTSW 15 102111411 missense probably damaging 1.00
R6067:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6079:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6130:Tns2 UTSW 15 102111241 missense probably damaging 1.00
R6136:Tns2 UTSW 15 102107030 missense probably damaging 1.00
R6138:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6199:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6210:Tns2 UTSW 15 102108934 missense probably damaging 1.00
R6426:Tns2 UTSW 15 102107037 missense possibly damaging 0.65
R6544:Tns2 UTSW 15 102113834 missense possibly damaging 0.93
R6594:Tns2 UTSW 15 102110559 missense probably benign 0.00
R6596:Tns2 UTSW 15 102110559 missense probably benign 0.00
R6734:Tns2 UTSW 15 102103116 missense probably damaging 0.96
U15987:Tns2 UTSW 15 102108934 missense probably damaging 1.00
X0009:Tns2 UTSW 15 102112465 missense possibly damaging 0.94
X0026:Tns2 UTSW 15 102110502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAGGATCTCATGATTCCTCC -3'
(R):5'- CCTGTGGAGTCTTTCTTACAAGC -3'

Sequencing Primer
(F):5'- CCTTCCCTGGGGTTTAGGTATAGAAG -3'
(R):5'- GCCAGAACGATCTAGTCTGTTTACG -3'
Posted On2014-10-16