Incidental Mutation 'R2253:Olfr1279'
ID241790
Institutional Source Beutler Lab
Gene Symbol Olfr1279
Ensembl Gene ENSMUSG00000109813
Gene Nameolfactory receptor 1279
SynonymsMOR245-12, GA_x6K02T2Q125-72357646-72358581
MMRRC Submission 040253-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R2253 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location111300635-111309043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111306310 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 35 (Y35C)
Ref Sequence ENSEMBL: ENSMUSP00000149972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062407] [ENSMUST00000090329] [ENSMUST00000213823] [ENSMUST00000216697]
Predicted Effect probably damaging
Transcript: ENSMUST00000062407
AA Change: Y35C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052153
Gene: ENSMUSG00000108931
AA Change: Y35C

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 7.2e-45 PFAM
Pfam:7TM_GPCR_Srsx 34 302 2.4e-5 PFAM
Pfam:7tm_1 41 287 2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090329
AA Change: Y37C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087801
Gene: ENSMUSG00000109813
AA Change: Y37C

DomainStartEndE-ValueType
Pfam:7tm_4 33 306 1.7e-44 PFAM
Pfam:7TM_GPCR_Srsx 36 300 3.2e-5 PFAM
Pfam:7tm_1 43 289 7.4e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213823
AA Change: Y35C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216697
AA Change: Y35C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G A 14: 59,142,612 S79F probably damaging Het
Acss3 G A 10: 107,004,748 A384V probably damaging Het
Aff2 G A X: 69,834,803 E732K possibly damaging Het
Atp12a A G 14: 56,376,258 T496A probably benign Het
B3gnt3 A T 8: 71,692,818 M302K probably damaging Het
Bptf G T 11: 107,111,322 D321E probably damaging Het
C1ql3 C T 2: 13,010,319 V177I possibly damaging Het
C2cd5 A T 6: 143,036,316 Y607* probably null Het
Casp3 G T 8: 46,637,955 W214L probably damaging Het
Cd248 A G 19: 5,068,126 M1V probably null Het
Cdh18 A G 15: 23,410,805 T405A probably benign Het
Cldn24 G T 8: 47,822,328 R62S probably benign Het
Cnot1 A G 8: 95,763,186 V463A probably benign Het
Cul2 A T 18: 3,399,876 L3F probably damaging Het
Ep400 A T 5: 110,719,091 N1062K unknown Het
Gch1 T C 14: 47,189,341 probably benign Het
Gm4985 G A X: 23,958,711 A75V probably benign Het
Gzf1 T C 2: 148,683,936 M109T probably damaging Het
Itch T A 2: 155,212,339 M701K probably benign Het
Kank4 A T 4: 98,779,226 I328N probably damaging Het
Krt9 A T 11: 100,190,859 N281K possibly damaging Het
Lgals12 T A 19: 7,606,765 probably benign Het
Lrrc37a T C 11: 103,501,467 Q1044R probably benign Het
Mbtps2 A T X: 157,559,033 F270L probably benign Het
Nr3c1 G T 18: 39,486,751 T161K probably benign Het
Olfr1471 T C 19: 13,445,185 Y58H probably damaging Het
Olfr317 T C 11: 58,732,995 T57A probably benign Het
Olfr988 A G 2: 85,353,858 S23P possibly damaging Het
Pla2g4d T C 2: 120,271,141 K453E probably damaging Het
Plcb2 T C 2: 118,723,765 N69S probably benign Het
Prl3d1 T C 13: 27,094,998 Y59H possibly damaging Het
Rnf133 T C 6: 23,649,175 M252V probably benign Het
Rnf181 G T 6: 72,361,484 H14N possibly damaging Het
Sash1 A T 10: 8,729,977 M883K probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Slc13a4 A G 6: 35,280,483 V240A probably benign Het
Slc2a5 T C 4: 150,139,990 Y315H possibly damaging Het
Slc7a2 T C 8: 40,905,621 Y334H probably benign Het
Spib A G 7: 44,529,968 S23P probably benign Het
Tbc1d1 A G 5: 64,284,800 N721S probably benign Het
Tcf25 A G 8: 123,374,033 E54G probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Uba7 A G 9: 107,976,364 H131R probably benign Het
Vmn2r6 C T 3: 64,559,718 C120Y probably damaging Het
Zdhhc18 A T 4: 133,633,077 probably null Het
Zfp970 T A 2: 177,474,821 probably null Het
Other mutations in Olfr1279
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Olfr1279 APN 2 111306621 missense probably benign 0.19
IGL01355:Olfr1279 APN 2 111307093 missense probably benign 0.00
IGL01864:Olfr1279 APN 2 111307055 missense probably damaging 1.00
IGL02160:Olfr1279 APN 2 111306798 missense probably benign 0.02
IGL02183:Olfr1279 APN 2 111306418 missense probably damaging 0.98
PIT4377001:Olfr1279 UTSW 2 111306880 missense probably damaging 1.00
R0280:Olfr1279 UTSW 2 111307072 missense possibly damaging 0.48
R0636:Olfr1279 UTSW 2 111306412 missense probably benign 0.06
R0732:Olfr1279 UTSW 2 111306980 nonsense probably null
R1661:Olfr1279 UTSW 2 111306771 missense probably damaging 1.00
R1665:Olfr1279 UTSW 2 111306771 missense probably damaging 1.00
R2251:Olfr1279 UTSW 2 111306310 missense probably damaging 1.00
R2252:Olfr1279 UTSW 2 111306310 missense probably damaging 1.00
R2473:Olfr1279 UTSW 2 111306891 missense probably damaging 1.00
R3408:Olfr1279 UTSW 2 111306505 missense probably damaging 1.00
R5020:Olfr1279 UTSW 2 111306292 missense probably benign 0.01
R5634:Olfr1279 UTSW 2 111307092 missense probably benign
R5647:Olfr1279 UTSW 2 111307047 missense possibly damaging 0.67
R6782:Olfr1279 UTSW 2 111306745 missense probably damaging 1.00
R6911:Olfr1279 UTSW 2 111306273 missense probably benign 0.00
R7135:Olfr1279 UTSW 2 111307020 missense probably benign 0.05
R7167:Olfr1279 UTSW 2 111306448 missense probably benign 0.10
X0021:Olfr1279 UTSW 2 111306588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGCTAGCCAACTCAGACGG -3'
(R):5'- TGAGTCATGCAATTGTGGAAAG -3'

Sequencing Primer
(F):5'- AGCCAACTCAGACGGTGTTTTTC -3'
(R):5'- GTGGAAAGAAATTACTTTGTGCTC -3'
Posted On2014-10-16