Incidental Mutation 'R0166:Tet1'
ID24182
Institutional Source Beutler Lab
Gene Symbol Tet1
Ensembl Gene ENSMUSG00000047146
Gene Nametet methylcytosine dioxygenase 1
SynonymsBB001228, 2510010B09Rik, D10Ertd17e, Cxxc6
MMRRC Submission 038442-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0166 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location62804570-62908996 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62840279 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 673 (T673S)
Ref Sequence ENSEMBL: ENSMUSP00000059527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050826] [ENSMUST00000174189]
Predicted Effect probably benign
Transcript: ENSMUST00000050826
AA Change: T673S

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000059527
Gene: ENSMUSG00000047146
AA Change: T673S

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Pfam:zf-CXXC 566 607 2.5e-11 PFAM
low complexity region 884 902 N/A INTRINSIC
low complexity region 1087 1106 N/A INTRINSIC
Tet_JBP 1528 1931 1e-171 SMART
low complexity region 1944 1956 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173081
Predicted Effect probably benign
Transcript: ENSMUST00000174189
AA Change: T673S

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000133279
Gene: ENSMUSG00000047146
AA Change: T673S

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Pfam:zf-CXXC 566 607 2.7e-10 PFAM
low complexity region 884 902 N/A INTRINSIC
low complexity region 1087 1106 N/A INTRINSIC
Tet_JBP 1528 1963 7.36e-170 SMART
low complexity region 1976 1988 N/A INTRINSIC
Meta Mutation Damage Score 0.1164 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA methylation is an epigenetic mechanism that is important for controlling gene expression. The protein encoded by this gene is a demethylase that belongs to the TET (ten-eleven translocation) family. Members of the TET protein family play a role in the DNA methylation process and gene activation. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit background sensitive lethality, abnormal forebrain development, abnormal female reproductive organs and decreased litter size. Mice homozygous for a different knock-out allele exhibit impaired adult neurogenesis, impaired spatial learning and impaired short-term memory retention. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,853,468 F1040L probably damaging Het
Adamts7 A G 9: 90,193,692 N1201S probably benign Het
Ahnak C T 19: 9,005,725 P1458S probably damaging Het
Akap6 T C 12: 53,140,924 V1707A probably benign Het
Akr1c21 T A 13: 4,581,264 V266E probably damaging Het
Arap2 A C 5: 62,676,018 C894G probably damaging Het
Atp2a2 T C 5: 122,466,838 D426G possibly damaging Het
Azi2 A T 9: 118,055,841 Q132L possibly damaging Het
Carmil1 C T 13: 24,099,049 D91N probably damaging Het
Cnot7 A T 8: 40,507,453 probably null Het
Cntnap5b A G 1: 100,274,361 E311G probably benign Het
Csmd1 A G 8: 16,233,022 V640A probably benign Het
Cst7 T C 2: 150,575,727 S31P probably benign Het
Cyp7b1 T A 3: 18,097,366 I228L probably benign Het
Ddx28 G A 8: 106,010,289 T379I probably benign Het
Dirc2 G A 16: 35,719,314 T379I possibly damaging Het
Drd1 T A 13: 54,053,581 I205F probably damaging Het
Flnb T A 14: 7,896,115 V837D probably damaging Het
Fsd1l A G 4: 53,647,664 probably null Het
Fubp1 T A 3: 152,220,204 Y264* probably null Het
Gbp5 T A 3: 142,506,919 probably null Het
Gm13088 T A 4: 143,654,511 H314L probably benign Het
Gm7094 A G 1: 21,272,734 noncoding transcript Het
Gpr55 A G 1: 85,941,136 V241A probably benign Het
Impa1 C T 3: 10,328,960 A16T probably damaging Het
Llgl2 T C 11: 115,844,854 L92P probably damaging Het
Ltbp2 T A 12: 84,786,358 Q1472L probably benign Het
Lyplal1 A T 1: 186,088,746 M168K probably benign Het
Macc1 A T 12: 119,447,080 R528* probably null Het
Mdm1 T A 10: 118,166,680 D635E probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mrpl23 C T 7: 142,535,114 R69W probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nr0b2 A G 4: 133,553,738 Q105R probably damaging Het
Olfr920 T A 9: 38,756,188 S167T probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Pcdhb14 A T 18: 37,448,489 probably null Het
Plxna1 A G 6: 89,333,019 W1055R probably damaging Het
Prdm1 C T 10: 44,440,091 R716Q probably damaging Het
Proser1 C A 3: 53,480,617 Q909K possibly damaging Het
Pus10 T A 11: 23,667,358 C24S probably damaging Het
Rpl27 T A 11: 101,445,320 F69I possibly damaging Het
Sctr A T 1: 120,055,394 I325F probably damaging Het
Slc5a3 G A 16: 92,077,693 V213I possibly damaging Het
Spib G T 7: 44,529,900 D28E probably damaging Het
Spic T C 10: 88,675,717 S226G possibly damaging Het
Tph1 A G 7: 46,647,596 F392L probably damaging Het
Ttc28 T C 5: 111,225,634 S979P probably benign Het
Unc79 T C 12: 103,156,553 L2110P probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Zfp467 T C 6: 48,438,681 T346A probably benign Het
Other mutations in Tet1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Tet1 APN 10 62814497 missense probably damaging 1.00
IGL01079:Tet1 APN 10 62879473 missense probably damaging 0.99
IGL01109:Tet1 APN 10 62879774 missense probably benign
IGL01634:Tet1 APN 10 62878588 missense possibly damaging 0.94
IGL02003:Tet1 APN 10 62816400 missense possibly damaging 0.92
IGL02081:Tet1 APN 10 62813818 missense probably damaging 1.00
IGL02100:Tet1 APN 10 62812728 missense possibly damaging 0.92
IGL02228:Tet1 APN 10 62813734 missense probably damaging 0.99
IGL02524:Tet1 APN 10 62878646 missense probably damaging 1.00
IGL02539:Tet1 APN 10 62813019 missense possibly damaging 0.60
IGL02608:Tet1 APN 10 62879609 missense possibly damaging 0.82
IGL02608:Tet1 APN 10 62839087 missense probably damaging 1.00
IGL02702:Tet1 APN 10 62879752 missense possibly damaging 0.83
K7371:Tet1 UTSW 10 62879176 missense probably benign
R0371:Tet1 UTSW 10 62878399 missense probably damaging 0.97
R0373:Tet1 UTSW 10 62878209 nonsense probably null
R0391:Tet1 UTSW 10 62814546 unclassified probably null
R0445:Tet1 UTSW 10 62879941 missense probably benign 0.08
R1016:Tet1 UTSW 10 62879950 missense probably benign
R1344:Tet1 UTSW 10 62814521 missense probably damaging 1.00
R1546:Tet1 UTSW 10 62812910 missense probably damaging 1.00
R1651:Tet1 UTSW 10 62879674 missense probably damaging 1.00
R1725:Tet1 UTSW 10 62814477 missense probably damaging 1.00
R1752:Tet1 UTSW 10 62812989 missense probably damaging 0.99
R1834:Tet1 UTSW 10 62813665 missense probably damaging 0.99
R1964:Tet1 UTSW 10 62812947 missense possibly damaging 0.86
R2239:Tet1 UTSW 10 62879734 missense probably benign 0.01
R2962:Tet1 UTSW 10 62814544 nonsense probably null
R3084:Tet1 UTSW 10 62879621 missense probably benign 0.34
R3086:Tet1 UTSW 10 62879621 missense probably benign 0.34
R3972:Tet1 UTSW 10 62813726 missense probably damaging 1.00
R4622:Tet1 UTSW 10 62819474 missense possibly damaging 0.92
R4674:Tet1 UTSW 10 62838848 missense probably damaging 0.97
R4687:Tet1 UTSW 10 62838791 missense probably benign 0.04
R4718:Tet1 UTSW 10 62813812 missense probably damaging 0.96
R4801:Tet1 UTSW 10 62822663 missense probably damaging 0.99
R4802:Tet1 UTSW 10 62822663 missense probably damaging 0.99
R4903:Tet1 UTSW 10 62822658 missense probably damaging 1.00
R5153:Tet1 UTSW 10 62878578 missense possibly damaging 0.85
R5193:Tet1 UTSW 10 62838247 missense probably benign 0.22
R5225:Tet1 UTSW 10 62838671 missense probably damaging 1.00
R5437:Tet1 UTSW 10 62814451 missense probably benign 0.01
R5465:Tet1 UTSW 10 62839777 missense probably benign
R5535:Tet1 UTSW 10 62832907 missense probably damaging 1.00
R5586:Tet1 UTSW 10 62878294 missense probably damaging 1.00
R5763:Tet1 UTSW 10 62840068 missense probably damaging 1.00
R5788:Tet1 UTSW 10 62839958 missense possibly damaging 0.70
R5818:Tet1 UTSW 10 62816408 missense possibly damaging 0.71
R5860:Tet1 UTSW 10 62812620 unclassified probably null
R5975:Tet1 UTSW 10 62879773 missense probably benign 0.37
R6041:Tet1 UTSW 10 62813373 missense probably damaging 0.98
R6092:Tet1 UTSW 10 62813715 missense probably benign 0.10
R6132:Tet1 UTSW 10 62813300 missense probably damaging 0.99
R6157:Tet1 UTSW 10 62839970 missense probably damaging 0.98
R6520:Tet1 UTSW 10 62880013 start codon destroyed probably null 0.53
R7210:Tet1 UTSW 10 62814501 missense probably null 0.95
R7223:Tet1 UTSW 10 62813671 missense possibly damaging 0.95
R7255:Tet1 UTSW 10 62822636 missense probably benign 0.15
R7323:Tet1 UTSW 10 62880039 start gained probably benign
R7472:Tet1 UTSW 10 62813350 missense possibly damaging 0.84
R7507:Tet1 UTSW 10 62832892 critical splice donor site probably null
R7522:Tet1 UTSW 10 62818983 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGCAGTTTGAGGGATCAGTCAGC -3'
(R):5'- GCATCTCCTTGTAGACATTCAGCGG -3'

Sequencing Primer
(F):5'- GAGGAATTATTTCCCAACGCCTTG -3'
(R):5'- AGACATTCAGCGGGTGGTG -3'
Posted On2013-04-16