Incidental Mutation 'R2254:Zfp64'
ID241854
Institutional Source Beutler Lab
Gene Symbol Zfp64
Ensembl Gene ENSMUSG00000027551
Gene Namezinc finger protein 64
Synonyms
MMRRC Submission 040254-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.566) question?
Stock #R2254 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location168893331-168955587 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 168926742 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 317 (H317Y)
Ref Sequence ENSEMBL: ENSMUSP00000085285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087971] [ENSMUST00000109162]
Predicted Effect probably damaging
Transcript: ENSMUST00000087971
AA Change: H317Y

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000085285
Gene: ENSMUSG00000027551
AA Change: H317Y

DomainStartEndE-ValueType
ZnF_C2H2 31 51 5.54e1 SMART
low complexity region 71 93 N/A INTRINSIC
ZnF_C2H2 142 167 1.68e1 SMART
ZnF_C2H2 173 195 2.24e-3 SMART
ZnF_C2H2 201 223 1.58e-3 SMART
ZnF_C2H2 229 251 2.24e-3 SMART
ZnF_C2H2 257 279 3.89e-3 SMART
ZnF_C2H2 285 308 6.32e-3 SMART
ZnF_C2H2 313 335 2.05e-2 SMART
ZnF_C2H2 341 363 1.95e-3 SMART
ZnF_C2H2 369 392 1.36e-2 SMART
ZnF_C2H2 423 445 1.47e-3 SMART
low complexity region 503 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109162
SMART Domains Protein: ENSMUSP00000104790
Gene: ENSMUSG00000027551

DomainStartEndE-ValueType
ZnF_C2H2 31 51 5.54e1 SMART
low complexity region 71 93 N/A INTRINSIC
ZnF_C2H2 142 167 1.68e1 SMART
ZnF_C2H2 173 195 2.24e-3 SMART
ZnF_C2H2 201 223 1.58e-3 SMART
ZnF_C2H2 229 251 2.24e-3 SMART
ZnF_C2H2 297 322 5.2e0 SMART
ZnF_C2H2 328 350 4.17e-3 SMART
ZnF_C2H2 356 378 6.78e-3 SMART
ZnF_C2H2 384 406 2.24e-3 SMART
ZnF_C2H2 412 434 1.79e-2 SMART
ZnF_C2H2 440 463 9.58e-3 SMART
ZnF_C2H2 465 487 3.78e-1 SMART
ZnF_C2H2 493 515 3.89e-3 SMART
ZnF_C2H2 521 544 1.92e-2 SMART
ZnF_C2H2 578 600 5.34e-1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,222,905 C243F probably damaging Het
Actn2 T C 13: 12,296,479 E260G probably benign Het
AI429214 G T 8: 36,993,766 D23Y possibly damaging Het
Alms1 A G 6: 85,619,848 Y1021C probably damaging Het
Ang5 A G 14: 43,962,617 D46G probably benign Het
Ano9 T A 7: 141,103,090 D635V probably benign Het
Apob C T 12: 8,011,256 T3246I possibly damaging Het
Arhgef25 T C 10: 127,189,521 E63G probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Cdh2 A T 18: 16,643,928 probably null Het
Chmp7 C T 14: 69,720,956 V255I probably damaging Het
Dnhd1 T A 7: 105,703,772 S2711T probably damaging Het
Gabrg1 T A 5: 70,782,364 K137* probably null Het
Gdi2 T A 13: 3,554,400 probably null Het
Glyr1 A G 16: 5,019,013 V429A probably benign Het
Gm5938 T A X: 78,128,555 probably null Het
Golt1b T C 6: 142,396,253 L121P probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Ifi204 G A 1: 173,761,730 T45M possibly damaging Het
Il18r1 A G 1: 40,491,220 N369S possibly damaging Het
Kcnh1 G T 1: 192,505,414 probably null Het
Kitl G A 10: 100,080,131 probably null Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Lax1 A G 1: 133,680,233 S257P probably damaging Het
Lepr T C 4: 101,815,112 I1111T probably benign Het
Lrrcc1 G A 3: 14,547,255 R356H probably damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Med11 T C 11: 70,452,095 probably null Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nup93 T C 8: 94,227,857 probably null Het
Olfr610 A G 7: 103,506,064 V294A probably damaging Het
Ovch2 A G 7: 107,790,195 V342A probably benign Het
Ovgp1 A G 3: 105,986,912 probably benign Het
Oxtr A T 6: 112,489,106 L231Q probably damaging Het
Prap1 A G 7: 140,096,162 T30A probably damaging Het
Scg2 G A 1: 79,436,500 P169S probably damaging Het
Scube2 A G 7: 109,825,459 V549A possibly damaging Het
Slc22a12 A T 19: 6,542,541 V57D possibly damaging Het
Slc22a28 A C 19: 8,064,493 C450G probably benign Het
Tas2r120 A T 6: 132,657,609 Q218L probably benign Het
Tbx15 A G 3: 99,351,874 T354A possibly damaging Het
Trim24 A G 6: 37,958,677 T868A probably benign Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr20rt T A 12: 65,226,233 W56R probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp40 T C 17: 23,178,370 D51G possibly damaging Het
Other mutations in Zfp64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Zfp64 APN 2 168926681 missense probably benign 0.06
IGL01479:Zfp64 APN 2 168951679 missense probably damaging 1.00
IGL02320:Zfp64 APN 2 168926198 missense probably damaging 0.98
IGL03411:Zfp64 APN 2 168951542 splice site probably null
PIT4362001:Zfp64 UTSW 2 168925815 missense probably benign 0.23
R0033:Zfp64 UTSW 2 168925715 missense possibly damaging 0.94
R0033:Zfp64 UTSW 2 168925715 missense possibly damaging 0.94
R0230:Zfp64 UTSW 2 168912230 splice site probably benign
R0325:Zfp64 UTSW 2 168926040 missense probably benign 0.00
R0689:Zfp64 UTSW 2 168935201 splice site probably benign
R1741:Zfp64 UTSW 2 168926318 missense probably benign 0.05
R2054:Zfp64 UTSW 2 168925808 missense probably damaging 1.00
R2133:Zfp64 UTSW 2 168940743 missense probably damaging 1.00
R4093:Zfp64 UTSW 2 168925935 missense probably benign 0.00
R4094:Zfp64 UTSW 2 168925935 missense probably benign 0.00
R4257:Zfp64 UTSW 2 168926378 missense probably damaging 1.00
R4630:Zfp64 UTSW 2 168926543 missense possibly damaging 0.94
R4642:Zfp64 UTSW 2 168934931 missense probably benign 0.22
R4817:Zfp64 UTSW 2 168926112 missense probably benign
R4880:Zfp64 UTSW 2 168894377 missense probably damaging 1.00
R5051:Zfp64 UTSW 2 168926384 missense probably damaging 0.98
R5155:Zfp64 UTSW 2 168906965 missense probably benign 0.17
R5562:Zfp64 UTSW 2 168925722 missense probably benign 0.00
R5619:Zfp64 UTSW 2 168899814 missense probably damaging 0.99
R5619:Zfp64 UTSW 2 168899815 missense probably damaging 0.97
R5620:Zfp64 UTSW 2 168899968 missense possibly damaging 0.70
R5919:Zfp64 UTSW 2 168926499 missense probably benign 0.05
R6156:Zfp64 UTSW 2 168926168 missense probably benign 0.34
R6364:Zfp64 UTSW 2 168912266 missense probably damaging 1.00
R6488:Zfp64 UTSW 2 168935209 critical splice donor site probably null
R6512:Zfp64 UTSW 2 168894077 missense probably benign 0.00
R6588:Zfp64 UTSW 2 168926907 missense probably damaging 1.00
R7103:Zfp64 UTSW 2 168926437 missense probably benign 0.00
R7313:Zfp64 UTSW 2 168899890 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGGTATCGAAGCTGCAG -3'
(R):5'- ACTCACCTTGTGTTGACAGG -3'

Sequencing Primer
(F):5'- CAGTAGCTGCACTTGAACGG -3'
(R):5'- TGTGTTGACAGGGGACGCC -3'
Posted On2014-10-16