Incidental Mutation 'R2254:Ovgp1'
ID241857
Institutional Source Beutler Lab
Gene Symbol Ovgp1
Ensembl Gene ENSMUSG00000074340
Gene Nameoviductal glycoprotein 1
SynonymsChit5, MOGP, muc9, mucin 9, OGP, oviductin
MMRRC Submission 040254-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2254 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location105973711-105987423 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 105986912 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000573] [ENSMUST00000163626]
Predicted Effect unknown
Transcript: ENSMUST00000000573
AA Change: K667R
SMART Domains Protein: ENSMUSP00000000573
Gene: ENSMUSG00000074340
AA Change: K667R

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Glyco_18 22 360 1.38e-134 SMART
low complexity region 486 515 N/A INTRINSIC
low complexity region 533 626 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000092878
Predicted Effect probably benign
Transcript: ENSMUST00000163626
SMART Domains Protein: ENSMUSP00000132424
Gene: ENSMUSG00000074340

DomainStartEndE-ValueType
Glyco_18 9 226 8.52e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167642
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, carbohydrate-rich, epithelial glycoprotein with numerous O-glycosylation sites located within threonine, serine, and proline-rich tandem repeats. The gene is similar to members of the mucin and the glycosyl hydrolase 18 gene families. Regulation of expression may be estrogen-dependent. Gene expression and protein secretion occur during late follicular development through early cleavage-stage embryonic development. The protein is secreted from non-ciliated oviductal epithelial cells and associates with ovulated oocytes, blastomeres, and spermatozoan acrosomal regions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show no phenotypic abnormalities. Female reproduction is essentially normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,222,905 C243F probably damaging Het
Actn2 T C 13: 12,296,479 E260G probably benign Het
AI429214 G T 8: 36,993,766 D23Y possibly damaging Het
Alms1 A G 6: 85,619,848 Y1021C probably damaging Het
Ang5 A G 14: 43,962,617 D46G probably benign Het
Ano9 T A 7: 141,103,090 D635V probably benign Het
Apob C T 12: 8,011,256 T3246I possibly damaging Het
Arhgef25 T C 10: 127,189,521 E63G probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Cdh2 A T 18: 16,643,928 probably null Het
Chmp7 C T 14: 69,720,956 V255I probably damaging Het
Dnhd1 T A 7: 105,703,772 S2711T probably damaging Het
Gabrg1 T A 5: 70,782,364 K137* probably null Het
Gdi2 T A 13: 3,554,400 probably null Het
Glyr1 A G 16: 5,019,013 V429A probably benign Het
Gm5938 T A X: 78,128,555 probably null Het
Golt1b T C 6: 142,396,253 L121P probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Ifi204 G A 1: 173,761,730 T45M possibly damaging Het
Il18r1 A G 1: 40,491,220 N369S possibly damaging Het
Kcnh1 G T 1: 192,505,414 probably null Het
Kitl G A 10: 100,080,131 probably null Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Lax1 A G 1: 133,680,233 S257P probably damaging Het
Lepr T C 4: 101,815,112 I1111T probably benign Het
Lrrcc1 G A 3: 14,547,255 R356H probably damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Med11 T C 11: 70,452,095 probably null Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nup93 T C 8: 94,227,857 probably null Het
Olfr610 A G 7: 103,506,064 V294A probably damaging Het
Ovch2 A G 7: 107,790,195 V342A probably benign Het
Oxtr A T 6: 112,489,106 L231Q probably damaging Het
Prap1 A G 7: 140,096,162 T30A probably damaging Het
Scg2 G A 1: 79,436,500 P169S probably damaging Het
Scube2 A G 7: 109,825,459 V549A possibly damaging Het
Slc22a12 A T 19: 6,542,541 V57D possibly damaging Het
Slc22a28 A C 19: 8,064,493 C450G probably benign Het
Tas2r120 A T 6: 132,657,609 Q218L probably benign Het
Tbx15 A G 3: 99,351,874 T354A possibly damaging Het
Trim24 A G 6: 37,958,677 T868A probably benign Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr20rt T A 12: 65,226,233 W56R probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp40 T C 17: 23,178,370 D51G possibly damaging Het
Zfp64 G A 2: 168,926,742 H317Y probably damaging Het
Other mutations in Ovgp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Ovgp1 APN 3 105981277 nonsense probably null
IGL01152:Ovgp1 APN 3 105986172 missense possibly damaging 0.94
IGL01458:Ovgp1 APN 3 105974991 missense probably benign 0.01
IGL01646:Ovgp1 APN 3 105978349 missense probably damaging 1.00
IGL01768:Ovgp1 APN 3 105981351 critical splice donor site probably null
IGL02712:Ovgp1 APN 3 105986513 unclassified probably benign
IGL03065:Ovgp1 APN 3 105986366 missense probably benign 0.01
IGL03140:Ovgp1 APN 3 105979906 missense probably damaging 1.00
IGL03272:Ovgp1 APN 3 105981325 missense probably damaging 0.99
PIT4472001:Ovgp1 UTSW 3 105986990 missense unknown
R0277:Ovgp1 UTSW 3 105979892 intron probably benign
R0560:Ovgp1 UTSW 3 105986410 unclassified probably benign
R0718:Ovgp1 UTSW 3 105974830 splice site probably benign
R0743:Ovgp1 UTSW 3 105974932 missense probably damaging 1.00
R1362:Ovgp1 UTSW 3 105986575 unclassified probably benign
R1556:Ovgp1 UTSW 3 105986752 unclassified probably benign
R1776:Ovgp1 UTSW 3 105977798 missense possibly damaging 0.52
R1831:Ovgp1 UTSW 3 105985068 missense probably benign 0.04
R1986:Ovgp1 UTSW 3 105974935 missense probably damaging 1.00
R2004:Ovgp1 UTSW 3 105986993 unclassified probably benign
R2156:Ovgp1 UTSW 3 105977717 missense possibly damaging 0.49
R2860:Ovgp1 UTSW 3 105986567 unclassified probably benign
R2861:Ovgp1 UTSW 3 105986567 unclassified probably benign
R3117:Ovgp1 UTSW 3 105986452 unclassified probably benign
R3793:Ovgp1 UTSW 3 105980171 missense probably benign 0.03
R3835:Ovgp1 UTSW 3 105986315 missense probably benign 0.00
R3894:Ovgp1 UTSW 3 105986567 unclassified probably benign
R3894:Ovgp1 UTSW 3 105986596 unclassified probably benign
R3895:Ovgp1 UTSW 3 105986596 unclassified probably benign
R4050:Ovgp1 UTSW 3 105986596 unclassified probably benign
R4050:Ovgp1 UTSW 3 105986567 unclassified probably benign
R4467:Ovgp1 UTSW 3 105977711 missense probably benign 0.04
R4611:Ovgp1 UTSW 3 105986567 unclassified probably benign
R4628:Ovgp1 UTSW 3 105980323 intron probably null
R4738:Ovgp1 UTSW 3 105979918 missense probably damaging 1.00
R4944:Ovgp1 UTSW 3 105979953 missense possibly damaging 0.66
R5110:Ovgp1 UTSW 3 105977783 missense probably damaging 1.00
R6531:Ovgp1 UTSW 3 105987071 unclassified probably benign
R6540:Ovgp1 UTSW 3 105986581 nonsense probably null
R6562:Ovgp1 UTSW 3 105980273 missense probably damaging 1.00
R6601:Ovgp1 UTSW 3 105986431 unclassified probably benign
R6906:Ovgp1 UTSW 3 105986873 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGACCACCACTGGCATTTCTC -3'
(R):5'- GACCAATTTCACCCATCTTGG -3'

Sequencing Primer
(F):5'- TGGCATTTCTAAGACCACCACTG -3'
(R):5'- GGGAGTACGTTTCTACCTCAGTAATC -3'
Posted On2014-10-16