Incidental Mutation 'R2254:Gabrg1'
ID241861
Institutional Source Beutler Lab
Gene Symbol Gabrg1
Ensembl Gene ENSMUSG00000001260
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit gamma 1
SynonymsGabaA
MMRRC Submission 040254-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R2254 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location70751047-70842617 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 70782364 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 137 (K137*)
Ref Sequence ENSEMBL: ENSMUSP00000142454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031119] [ENSMUST00000199705]
Predicted Effect probably null
Transcript: ENSMUST00000031119
AA Change: K142*
SMART Domains Protein: ENSMUSP00000031119
Gene: ENSMUSG00000001260
AA Change: K142*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 40 46 N/A INTRINSIC
Pfam:Neur_chan_LBD 64 270 7e-51 PFAM
Pfam:Neur_chan_memb 277 378 2.3e-36 PFAM
low complexity region 411 422 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197068
Predicted Effect probably null
Transcript: ENSMUST00000199705
AA Change: K137*
SMART Domains Protein: ENSMUSP00000142454
Gene: ENSMUSG00000001260
AA Change: K137*

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 35 41 N/A INTRINSIC
Pfam:Neur_chan_LBD 59 265 1.7e-50 PFAM
Pfam:Neur_chan_memb 272 304 9.5e-12 PFAM
low complexity region 365 376 N/A INTRINSIC
transmembrane domain 395 417 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ligand-gated ionic channel family. It is an integral membrane protein and plays an important role in inhibiting neurotransmission by binding to the benzodiazepine receptor and opening an integral chloride channel. This gene is clustered with three other family members on chromosome 4. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,222,905 C243F probably damaging Het
Actn2 T C 13: 12,296,479 E260G probably benign Het
AI429214 G T 8: 36,993,766 D23Y possibly damaging Het
Alms1 A G 6: 85,619,848 Y1021C probably damaging Het
Ang5 A G 14: 43,962,617 D46G probably benign Het
Ano9 T A 7: 141,103,090 D635V probably benign Het
Apob C T 12: 8,011,256 T3246I possibly damaging Het
Arhgef25 T C 10: 127,189,521 E63G probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Cdh2 A T 18: 16,643,928 probably null Het
Chmp7 C T 14: 69,720,956 V255I probably damaging Het
Dnhd1 T A 7: 105,703,772 S2711T probably damaging Het
Gdi2 T A 13: 3,554,400 probably null Het
Glyr1 A G 16: 5,019,013 V429A probably benign Het
Gm5938 T A X: 78,128,555 probably null Het
Golt1b T C 6: 142,396,253 L121P probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Ifi204 G A 1: 173,761,730 T45M possibly damaging Het
Il18r1 A G 1: 40,491,220 N369S possibly damaging Het
Kcnh1 G T 1: 192,505,414 probably null Het
Kitl G A 10: 100,080,131 probably null Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Lax1 A G 1: 133,680,233 S257P probably damaging Het
Lepr T C 4: 101,815,112 I1111T probably benign Het
Lrrcc1 G A 3: 14,547,255 R356H probably damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Med11 T C 11: 70,452,095 probably null Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nup93 T C 8: 94,227,857 probably null Het
Olfr610 A G 7: 103,506,064 V294A probably damaging Het
Ovch2 A G 7: 107,790,195 V342A probably benign Het
Ovgp1 A G 3: 105,986,912 probably benign Het
Oxtr A T 6: 112,489,106 L231Q probably damaging Het
Prap1 A G 7: 140,096,162 T30A probably damaging Het
Scg2 G A 1: 79,436,500 P169S probably damaging Het
Scube2 A G 7: 109,825,459 V549A possibly damaging Het
Slc22a12 A T 19: 6,542,541 V57D possibly damaging Het
Slc22a28 A C 19: 8,064,493 C450G probably benign Het
Tas2r120 A T 6: 132,657,609 Q218L probably benign Het
Tbx15 A G 3: 99,351,874 T354A possibly damaging Het
Trim24 A G 6: 37,958,677 T868A probably benign Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr20rt T A 12: 65,226,233 W56R probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp40 T C 17: 23,178,370 D51G possibly damaging Het
Zfp64 G A 2: 168,926,742 H317Y probably damaging Het
Other mutations in Gabrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Gabrg1 APN 5 70815955 critical splice donor site probably null
IGL00798:Gabrg1 APN 5 70782283 missense probably damaging 1.00
IGL01012:Gabrg1 APN 5 70778169 missense probably benign 0.03
IGL01597:Gabrg1 APN 5 70782348 missense probably damaging 1.00
IGL01637:Gabrg1 APN 5 70777205 missense probably damaging 1.00
IGL02589:Gabrg1 APN 5 70842152 nonsense probably null
IGL03031:Gabrg1 APN 5 70794682 nonsense probably null
IGL03346:Gabrg1 APN 5 70778131 missense possibly damaging 0.89
PIT4260001:Gabrg1 UTSW 5 70782280 missense probably benign 0.01
R0197:Gabrg1 UTSW 5 70774389 missense probably damaging 1.00
R1271:Gabrg1 UTSW 5 70777144 missense probably damaging 0.98
R1795:Gabrg1 UTSW 5 70782253 missense possibly damaging 0.83
R1817:Gabrg1 UTSW 5 70754251 missense probably benign 0.08
R1820:Gabrg1 UTSW 5 70774413 missense probably damaging 1.00
R4566:Gabrg1 UTSW 5 70842141 missense probably benign 0.01
R4768:Gabrg1 UTSW 5 70754173 missense probably damaging 0.99
R4976:Gabrg1 UTSW 5 70774411 missense possibly damaging 0.95
R5104:Gabrg1 UTSW 5 70774432 missense probably damaging 1.00
R6062:Gabrg1 UTSW 5 70780713 missense probably damaging 1.00
R6086:Gabrg1 UTSW 5 70754053 missense probably damaging 1.00
R6148:Gabrg1 UTSW 5 70774461 missense probably damaging 1.00
R6234:Gabrg1 UTSW 5 70842141 missense probably benign 0.01
R6724:Gabrg1 UTSW 5 70754209 missense possibly damaging 0.80
R6786:Gabrg1 UTSW 5 70754267 missense probably benign 0.00
R6794:Gabrg1 UTSW 5 70815971 missense probably damaging 1.00
R7209:Gabrg1 UTSW 5 70754170 missense probably damaging 0.98
X0027:Gabrg1 UTSW 5 70754261 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTCACCAAAACAGTTCTCC -3'
(R):5'- GCCAATTTCTCAGGAAAGCATC -3'

Sequencing Primer
(F):5'- TTTAGCCAATAAAAGGGGTCCC -3'
(R):5'- TTCTCAGGAAAGCATCTGAAATG -3'
Posted On2014-10-16