Incidental Mutation 'R2254:B3gnt4'
ID241862
Institutional Source Beutler Lab
Gene Symbol B3gnt4
Ensembl Gene ENSMUSG00000029431
Gene NameUDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4
Synonyms
MMRRC Submission 040254-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R2254 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location123510460-123511882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 123511279 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 236 (I236L)
Ref Sequence ENSEMBL: ENSMUSP00000031384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031384] [ENSMUST00000094327] [ENSMUST00000111586] [ENSMUST00000111587] [ENSMUST00000121444] [ENSMUST00000125652] [ENSMUST00000139398] [ENSMUST00000145152] [ENSMUST00000196809] [ENSMUST00000197682] [ENSMUST00000200247]
Predicted Effect probably damaging
Transcript: ENSMUST00000031384
AA Change: I236L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031384
Gene: ENSMUSG00000029431
AA Change: I236L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Galactosyl_T 106 297 1.3e-43 PFAM
Pfam:Fringe 169 302 2.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094327
SMART Domains Protein: ENSMUSP00000091885
Gene: ENSMUSG00000063409

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
SCOP:d1a9na_ 117 262 3e-16 SMART
low complexity region 389 402 N/A INTRINSIC
low complexity region 537 565 N/A INTRINSIC
low complexity region 614 629 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111586
SMART Domains Protein: ENSMUSP00000107213
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 6 174 7.6e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111587
SMART Domains Protein: ENSMUSP00000107214
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 9 237 4.1e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121444
SMART Domains Protein: ENSMUSP00000113933
Gene: ENSMUSG00000063409

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
SCOP:d1a9na_ 117 262 4e-16 SMART
low complexity region 389 402 N/A INTRINSIC
low complexity region 530 558 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125652
SMART Domains Protein: ENSMUSP00000115045
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 6 237 1.1e-111 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134552
Predicted Effect probably benign
Transcript: ENSMUST00000139398
SMART Domains Protein: ENSMUSP00000143485
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 6 150 7.1e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145152
SMART Domains Protein: ENSMUSP00000143617
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 9 150 3.4e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196809
SMART Domains Protein: ENSMUSP00000143602
Gene: ENSMUSG00000063409

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
SCOP:d1a9na_ 117 262 2e-16 SMART
low complexity region 389 402 N/A INTRINSIC
low complexity region 537 565 N/A INTRINSIC
low complexity region 635 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197682
Predicted Effect probably benign
Transcript: ENSMUST00000200247
SMART Domains Protein: ENSMUSP00000143673
Gene: ENSMUSG00000029433

DomainStartEndE-ValueType
Pfam:Smac_DIABLO 1 109 4.4e-57 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase protein family. The encoded enzyme is involved in the biosynthesis of poly-N-acetyllactosamine chains and prefers lacto-N-neotetraose as a substrate. It is a type II transmembrane protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,222,905 C243F probably damaging Het
Actn2 T C 13: 12,296,479 E260G probably benign Het
AI429214 G T 8: 36,993,766 D23Y possibly damaging Het
Alms1 A G 6: 85,619,848 Y1021C probably damaging Het
Ang5 A G 14: 43,962,617 D46G probably benign Het
Ano9 T A 7: 141,103,090 D635V probably benign Het
Apob C T 12: 8,011,256 T3246I possibly damaging Het
Arhgef25 T C 10: 127,189,521 E63G probably benign Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Cdh2 A T 18: 16,643,928 probably null Het
Chmp7 C T 14: 69,720,956 V255I probably damaging Het
Dnhd1 T A 7: 105,703,772 S2711T probably damaging Het
Gabrg1 T A 5: 70,782,364 K137* probably null Het
Gdi2 T A 13: 3,554,400 probably null Het
Glyr1 A G 16: 5,019,013 V429A probably benign Het
Gm5938 T A X: 78,128,555 probably null Het
Golt1b T C 6: 142,396,253 L121P probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Ifi204 G A 1: 173,761,730 T45M possibly damaging Het
Il18r1 A G 1: 40,491,220 N369S possibly damaging Het
Kcnh1 G T 1: 192,505,414 probably null Het
Kitl G A 10: 100,080,131 probably null Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Lax1 A G 1: 133,680,233 S257P probably damaging Het
Lepr T C 4: 101,815,112 I1111T probably benign Het
Lrrcc1 G A 3: 14,547,255 R356H probably damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Med11 T C 11: 70,452,095 probably null Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nup93 T C 8: 94,227,857 probably null Het
Olfr610 A G 7: 103,506,064 V294A probably damaging Het
Ovch2 A G 7: 107,790,195 V342A probably benign Het
Ovgp1 A G 3: 105,986,912 probably benign Het
Oxtr A T 6: 112,489,106 L231Q probably damaging Het
Prap1 A G 7: 140,096,162 T30A probably damaging Het
Scg2 G A 1: 79,436,500 P169S probably damaging Het
Scube2 A G 7: 109,825,459 V549A possibly damaging Het
Slc22a12 A T 19: 6,542,541 V57D possibly damaging Het
Slc22a28 A C 19: 8,064,493 C450G probably benign Het
Tas2r120 A T 6: 132,657,609 Q218L probably benign Het
Tbx15 A G 3: 99,351,874 T354A possibly damaging Het
Trim24 A G 6: 37,958,677 T868A probably benign Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr20rt T A 12: 65,226,233 W56R probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp40 T C 17: 23,178,370 D51G possibly damaging Het
Zfp64 G A 2: 168,926,742 H317Y probably damaging Het
Other mutations in B3gnt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:B3gnt4 APN 5 123511068 missense probably damaging 1.00
IGL01791:B3gnt4 APN 5 123511099 missense probably damaging 1.00
IGL02825:B3gnt4 APN 5 123511051 missense possibly damaging 0.58
R1996:B3gnt4 UTSW 5 123511339 missense probably damaging 1.00
R2070:B3gnt4 UTSW 5 123511370 missense probably benign 0.00
R2071:B3gnt4 UTSW 5 123511370 missense probably benign 0.00
R2255:B3gnt4 UTSW 5 123511279 missense probably damaging 0.99
R3153:B3gnt4 UTSW 5 123510653 missense probably benign 0.00
R3608:B3gnt4 UTSW 5 123510775 missense probably damaging 1.00
R5021:B3gnt4 UTSW 5 123510947 missense probably damaging 0.98
R6438:B3gnt4 UTSW 5 123511591 missense probably benign 0.02
R6496:B3gnt4 UTSW 5 123511591 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTTTAACCTGACTCTCAAGGAGC -3'
(R):5'- GCATGGTGTATGGGAGTCAC -3'

Sequencing Primer
(F):5'- TGACTCTCAAGGAGCTGCAC -3'
(R):5'- ACCCCCAGCTTCCTCAGG -3'
Posted On2014-10-16