Incidental Mutation 'R0166:Rpl27'
ID24187
Institutional Source Beutler Lab
Gene Symbol Rpl27
Ensembl Gene ENSMUSG00000063316
Gene Nameribosomal protein L27
Synonyms
MMRRC Submission 038442-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R0166 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location101442298-101445529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101445320 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 69 (F69I)
Ref Sequence ENSEMBL: ENSMUSP00000120418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010502] [ENSMUST00000077856] [ENSMUST00000107249] [ENSMUST00000127514] [ENSMUST00000131024]
Predicted Effect probably benign
Transcript: ENSMUST00000010502
SMART Domains Protein: ENSMUSP00000010502
Gene: ENSMUSG00000010358

DomainStartEndE-ValueType
Pfam:IFP_35_N 8 80 9.1e-21 PFAM
Pfam:NID 81 170 1.5e-31 PFAM
Pfam:NID 179 266 1.6e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000077856
AA Change: F118I

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090305
Gene: ENSMUSG00000063316
AA Change: F118I

DomainStartEndE-ValueType
KOW 4 31 2.14e-3 SMART
Pfam:Ribosomal_L27e 52 136 1.5e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107249
AA Change: F118I

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102870
Gene: ENSMUSG00000063316
AA Change: F118I

DomainStartEndE-ValueType
KOW 4 31 2.14e-3 SMART
Pfam:Ribosomal_L27e 52 136 1.1e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125958
Predicted Effect possibly damaging
Transcript: ENSMUST00000127514
AA Change: F69I

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120418
Gene: ENSMUSG00000063316
AA Change: F69I

DomainStartEndE-ValueType
Pfam:Ribosomal_L27e 1 32 5.3e-12 PFAM
Pfam:Ribosomal_L27e 30 87 1.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131024
SMART Domains Protein: ENSMUSP00000117189
Gene: ENSMUSG00000010358

DomainStartEndE-ValueType
Pfam:IFP_35_N 8 45 2.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152162
Meta Mutation Damage Score 0.45 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L27E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b T C 5: 8,853,468 F1040L probably damaging Het
Adamts7 A G 9: 90,193,692 N1201S probably benign Het
Ahnak C T 19: 9,005,725 P1458S probably damaging Het
Akap6 T C 12: 53,140,924 V1707A probably benign Het
Akr1c21 T A 13: 4,581,264 V266E probably damaging Het
Arap2 A C 5: 62,676,018 C894G probably damaging Het
Atp2a2 T C 5: 122,466,838 D426G possibly damaging Het
Azi2 A T 9: 118,055,841 Q132L possibly damaging Het
Carmil1 C T 13: 24,099,049 D91N probably damaging Het
Cnot7 A T 8: 40,507,453 probably null Het
Cntnap5b A G 1: 100,274,361 E311G probably benign Het
Csmd1 A G 8: 16,233,022 V640A probably benign Het
Cst7 T C 2: 150,575,727 S31P probably benign Het
Cyp7b1 T A 3: 18,097,366 I228L probably benign Het
Ddx28 G A 8: 106,010,289 T379I probably benign Het
Dirc2 G A 16: 35,719,314 T379I possibly damaging Het
Drd1 T A 13: 54,053,581 I205F probably damaging Het
Flnb T A 14: 7,896,115 V837D probably damaging Het
Fsd1l A G 4: 53,647,664 probably null Het
Fubp1 T A 3: 152,220,204 Y264* probably null Het
Gbp5 T A 3: 142,506,919 probably null Het
Gm13088 T A 4: 143,654,511 H314L probably benign Het
Gm7094 A G 1: 21,272,734 noncoding transcript Het
Gpr55 A G 1: 85,941,136 V241A probably benign Het
Impa1 C T 3: 10,328,960 A16T probably damaging Het
Llgl2 T C 11: 115,844,854 L92P probably damaging Het
Ltbp2 T A 12: 84,786,358 Q1472L probably benign Het
Lyplal1 A T 1: 186,088,746 M168K probably benign Het
Macc1 A T 12: 119,447,080 R528* probably null Het
Mdm1 T A 10: 118,166,680 D635E probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mrpl23 C T 7: 142,535,114 R69W probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nr0b2 A G 4: 133,553,738 Q105R probably damaging Het
Olfr920 T A 9: 38,756,188 S167T probably benign Het
Otog G A 7: 46,304,231 V2638M probably damaging Het
Pcdhb14 A T 18: 37,448,489 probably null Het
Plxna1 A G 6: 89,333,019 W1055R probably damaging Het
Prdm1 C T 10: 44,440,091 R716Q probably damaging Het
Proser1 C A 3: 53,480,617 Q909K possibly damaging Het
Pus10 T A 11: 23,667,358 C24S probably damaging Het
Sctr A T 1: 120,055,394 I325F probably damaging Het
Slc5a3 G A 16: 92,077,693 V213I possibly damaging Het
Spib G T 7: 44,529,900 D28E probably damaging Het
Spic T C 10: 88,675,717 S226G possibly damaging Het
Tet1 T A 10: 62,840,279 T673S probably benign Het
Tph1 A G 7: 46,647,596 F392L probably damaging Het
Ttc28 T C 5: 111,225,634 S979P probably benign Het
Unc79 T C 12: 103,156,553 L2110P probably damaging Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Zfp467 T C 6: 48,438,681 T346A probably benign Het
Other mutations in Rpl27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02644:Rpl27 APN 11 101445491 unclassified probably benign
R0319:Rpl27 UTSW 11 101443495 unclassified probably benign
R0492:Rpl27 UTSW 11 101445255 missense possibly damaging 0.72
R6358:Rpl27 UTSW 11 101443956 unclassified probably benign
R7148:Rpl27 UTSW 11 101442406 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCATGCAAGTTCACTCAGCTCAGG -3'
(R):5'- GATGGTTACCAAGCCCAGGTTCAC -3'

Sequencing Primer
(F):5'- ACAAGTGTGTGCCATACCTG -3'
(R):5'- CAAATGCAATAGGCAGACACTTG -3'
Posted On2013-04-16