Incidental Mutation 'R2254:Gpi1'
ID241870
Institutional Source Beutler Lab
Gene Symbol Gpi1
Ensembl Gene ENSMUSG00000036427
Gene Nameglucose phosphate isomerase 1
Synonymsneuroleukin, MF, Gpi-1t, Gpi-1s, Gpi-1r, maturation factor, Org, NK, NK/GPI, Gpi-1, AMF, Gpi1-t, Gpi1-s, Gpi1-r, autocrine motility factor
MMRRC Submission 040254-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2254 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location34201330-34230336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34202877 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 471 (N471S)
Ref Sequence ENSEMBL: ENSMUSP00000049355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038027] [ENSMUST00000205870] [ENSMUST00000205983] [ENSMUST00000206415]
PDB Structure
Crystal structure of mouse phosphoglucose isomerase [X-RAY DIFFRACTION]
Crystal structure of mouse phosphoglucose isomerase in complex with glucose 6-phosphate [X-RAY DIFFRACTION]
Crystal structure of mouse phosphoglucose isomerase in complex with erythrose 4-phosphate [X-RAY DIFFRACTION]
Crystal structure of mouse AMF [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / phosphate complex [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / E4P complex [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / A5P complex [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / S6P complex [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / 6PG complex [X-RAY DIFFRACTION]
Crystal structure of mouse AMF / F6P complex [X-RAY DIFFRACTION]
>> 2 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000038027
AA Change: N471S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049355
Gene: ENSMUSG00000036427
AA Change: N471S

DomainStartEndE-ValueType
Pfam:PGI 54 546 1e-265 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135243
Predicted Effect unknown
Transcript: ENSMUST00000205800
AA Change: N103S
Predicted Effect probably benign
Transcript: ENSMUST00000205865
Predicted Effect probably benign
Transcript: ENSMUST00000205870
Predicted Effect probably benign
Transcript: ENSMUST00000205983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206232
Predicted Effect probably benign
Transcript: ENSMUST00000206415
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the glucose phosphate isomerase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. In the cytoplasm, the gene product functions as a glycolytic enzyme (glucose-6-phosphate isomerase) that interconverts glucose-6-phosphate and fructose-6-phosphate. Extracellularly, the encoded protein (also referred to as neuroleukin) functions as a neurotrophic factor that promotes survival of skeletal motor neurons and sensory neurons, and as a lymphokine that induces immunoglobulin secretion. The encoded protein is also referred to as autocrine motility factor based on an additional function as a tumor-secreted cytokine and angiogenic factor. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for null mutations fail to develop beyond the egg cylinder stage and die by embryonic day 9.5. Homozygotes for a hypomorphic mutation exhibit nonspherocytic hemolytic anemia with hepatosplenomegaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,222,905 C243F probably damaging Het
Actn2 T C 13: 12,296,479 E260G probably benign Het
AI429214 G T 8: 36,993,766 D23Y possibly damaging Het
Alms1 A G 6: 85,619,848 Y1021C probably damaging Het
Ang5 A G 14: 43,962,617 D46G probably benign Het
Ano9 T A 7: 141,103,090 D635V probably benign Het
Apob C T 12: 8,011,256 T3246I possibly damaging Het
Arhgef25 T C 10: 127,189,521 E63G probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Cdh2 A T 18: 16,643,928 probably null Het
Chmp7 C T 14: 69,720,956 V255I probably damaging Het
Dnhd1 T A 7: 105,703,772 S2711T probably damaging Het
Gabrg1 T A 5: 70,782,364 K137* probably null Het
Gdi2 T A 13: 3,554,400 probably null Het
Glyr1 A G 16: 5,019,013 V429A probably benign Het
Gm5938 T A X: 78,128,555 probably null Het
Golt1b T C 6: 142,396,253 L121P probably damaging Het
Ifi204 G A 1: 173,761,730 T45M possibly damaging Het
Il18r1 A G 1: 40,491,220 N369S possibly damaging Het
Kcnh1 G T 1: 192,505,414 probably null Het
Kitl G A 10: 100,080,131 probably null Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Lax1 A G 1: 133,680,233 S257P probably damaging Het
Lepr T C 4: 101,815,112 I1111T probably benign Het
Lrrcc1 G A 3: 14,547,255 R356H probably damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Med11 T C 11: 70,452,095 probably null Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nup93 T C 8: 94,227,857 probably null Het
Olfr610 A G 7: 103,506,064 V294A probably damaging Het
Ovch2 A G 7: 107,790,195 V342A probably benign Het
Ovgp1 A G 3: 105,986,912 probably benign Het
Oxtr A T 6: 112,489,106 L231Q probably damaging Het
Prap1 A G 7: 140,096,162 T30A probably damaging Het
Scg2 G A 1: 79,436,500 P169S probably damaging Het
Scube2 A G 7: 109,825,459 V549A possibly damaging Het
Slc22a12 A T 19: 6,542,541 V57D possibly damaging Het
Slc22a28 A C 19: 8,064,493 C450G probably benign Het
Tas2r120 A T 6: 132,657,609 Q218L probably benign Het
Tbx15 A G 3: 99,351,874 T354A possibly damaging Het
Trim24 A G 6: 37,958,677 T868A probably benign Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr20rt T A 12: 65,226,233 W56R probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp40 T C 17: 23,178,370 D51G possibly damaging Het
Zfp64 G A 2: 168,926,742 H317Y probably damaging Het
Other mutations in Gpi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Gpi1 APN 7 34215950 intron probably benign
IGL01911:Gpi1 APN 7 34220922 missense probably damaging 1.00
IGL02155:Gpi1 APN 7 34230189 missense possibly damaging 0.94
R0019:Gpi1 UTSW 7 34220899 missense probably damaging 0.99
R1413:Gpi1 UTSW 7 34230155 missense probably benign 0.22
R1974:Gpi1 UTSW 7 34220803 intron probably null
R2132:Gpi1 UTSW 7 34205914 missense probably damaging 1.00
R2255:Gpi1 UTSW 7 34202877 missense probably damaging 1.00
R2435:Gpi1 UTSW 7 34205829 missense probably damaging 1.00
R2509:Gpi1 UTSW 7 34205923 missense probably damaging 1.00
R2510:Gpi1 UTSW 7 34205923 missense probably damaging 1.00
R3408:Gpi1 UTSW 7 34202679 missense probably damaging 0.99
R5059:Gpi1 UTSW 7 34207688 missense probably damaging 1.00
R5141:Gpi1 UTSW 7 34227096 intron probably benign
R5272:Gpi1 UTSW 7 34220690 missense probably damaging 1.00
R5980:Gpi1 UTSW 7 34228926 critical splice donor site probably null
R6261:Gpi1 UTSW 7 34220745 missense possibly damaging 0.93
R6788:Gpi1 UTSW 7 34228990 missense probably damaging 1.00
R6835:Gpi1 UTSW 7 34227138 missense possibly damaging 0.89
R6989:Gpi1 UTSW 7 34202520 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCATACATGGCTGCAGAG -3'
(R):5'- TGACTCTGGTCCTGGAATATGG -3'

Sequencing Primer
(F):5'- CTCATACATGGCTGCAGAGGAAAC -3'
(R):5'- CAAGACAATGTCTCCTTGGAGTC -3'
Posted On2014-10-16