Incidental Mutation 'R2254:Olfr610'
ID241872
Institutional Source Beutler Lab
Gene Symbol Olfr610
Ensembl Gene ENSMUSG00000045584
Gene Nameolfactory receptor 610
SynonymsMOR9-2, GA_x6K02T2PBJ9-6221839-6220892
MMRRC Submission 040254-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R2254 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103505375-103512122 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103506064 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 294 (V294A)
Ref Sequence ENSEMBL: ENSMUSP00000150921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063109] [ENSMUST00000217627]
Predicted Effect probably damaging
Transcript: ENSMUST00000063109
AA Change: V294A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052577
Gene: ENSMUSG00000045584
AA Change: V294A

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 3.5e-106 PFAM
Pfam:7TM_GPCR_Srsx 37 310 1.9e-10 PFAM
Pfam:7tm_1 43 295 1.4e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213422
Predicted Effect probably damaging
Transcript: ENSMUST00000217627
AA Change: V294A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,222,905 C243F probably damaging Het
Actn2 T C 13: 12,296,479 E260G probably benign Het
AI429214 G T 8: 36,993,766 D23Y possibly damaging Het
Alms1 A G 6: 85,619,848 Y1021C probably damaging Het
Ang5 A G 14: 43,962,617 D46G probably benign Het
Ano9 T A 7: 141,103,090 D635V probably benign Het
Apob C T 12: 8,011,256 T3246I possibly damaging Het
Arhgef25 T C 10: 127,189,521 E63G probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Cdh2 A T 18: 16,643,928 probably null Het
Chmp7 C T 14: 69,720,956 V255I probably damaging Het
Dnhd1 T A 7: 105,703,772 S2711T probably damaging Het
Gabrg1 T A 5: 70,782,364 K137* probably null Het
Gdi2 T A 13: 3,554,400 probably null Het
Glyr1 A G 16: 5,019,013 V429A probably benign Het
Gm5938 T A X: 78,128,555 probably null Het
Golt1b T C 6: 142,396,253 L121P probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Ifi204 G A 1: 173,761,730 T45M possibly damaging Het
Il18r1 A G 1: 40,491,220 N369S possibly damaging Het
Kcnh1 G T 1: 192,505,414 probably null Het
Kitl G A 10: 100,080,131 probably null Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Lax1 A G 1: 133,680,233 S257P probably damaging Het
Lepr T C 4: 101,815,112 I1111T probably benign Het
Lrrcc1 G A 3: 14,547,255 R356H probably damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Med11 T C 11: 70,452,095 probably null Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nup93 T C 8: 94,227,857 probably null Het
Ovch2 A G 7: 107,790,195 V342A probably benign Het
Ovgp1 A G 3: 105,986,912 probably benign Het
Oxtr A T 6: 112,489,106 L231Q probably damaging Het
Prap1 A G 7: 140,096,162 T30A probably damaging Het
Scg2 G A 1: 79,436,500 P169S probably damaging Het
Scube2 A G 7: 109,825,459 V549A possibly damaging Het
Slc22a12 A T 19: 6,542,541 V57D possibly damaging Het
Slc22a28 A C 19: 8,064,493 C450G probably benign Het
Tas2r120 A T 6: 132,657,609 Q218L probably benign Het
Tbx15 A G 3: 99,351,874 T354A possibly damaging Het
Trim24 A G 6: 37,958,677 T868A probably benign Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr20rt T A 12: 65,226,233 W56R probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp40 T C 17: 23,178,370 D51G possibly damaging Het
Zfp64 G A 2: 168,926,742 H317Y probably damaging Het
Other mutations in Olfr610
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Olfr610 APN 7 103506796 missense possibly damaging 0.67
IGL02179:Olfr610 APN 7 103506727 missense probably damaging 1.00
IGL02303:Olfr610 APN 7 103506088 missense probably benign 0.05
IGL02507:Olfr610 APN 7 103506718 nonsense probably null
IGL02562:Olfr610 APN 7 103506216 nonsense probably null
IGL02806:Olfr610 APN 7 103506003 missense probably benign 0.10
R0743:Olfr610 UTSW 7 103506862 nonsense probably null
R0884:Olfr610 UTSW 7 103506862 nonsense probably null
R1673:Olfr610 UTSW 7 103506689 missense probably damaging 0.99
R1752:Olfr610 UTSW 7 103506558 missense probably benign 0.02
R1800:Olfr610 UTSW 7 103506041 missense possibly damaging 0.89
R2043:Olfr610 UTSW 7 103506943 start codon destroyed probably null 0.98
R2566:Olfr610 UTSW 7 103506160 missense probably benign 0.08
R4433:Olfr610 UTSW 7 103506139 missense probably benign 0.04
R5206:Olfr610 UTSW 7 103506102 nonsense probably null
R5470:Olfr610 UTSW 7 103506509 missense probably benign 0.00
R6020:Olfr610 UTSW 7 103506799 missense probably benign
R6848:Olfr610 UTSW 7 103506457 missense possibly damaging 0.50
R7222:Olfr610 UTSW 7 103506457 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- AGTTATGCGTTTGATAGAGGAATCC -3'
(R):5'- TGAAAGCCTTCAACACTTGC -3'

Sequencing Primer
(F):5'- CGTTTGATAGAGGAATCCACACTG -3'
(R):5'- GAAAGCCTTCAACACTTGCATTTC -3'
Posted On2014-10-16