Incidental Mutation 'R2254:Nup93'
ID241880
Institutional Source Beutler Lab
Gene Symbol Nup93
Ensembl Gene ENSMUSG00000032939
Gene Namenucleoporin 93
Synonyms2410008G02Rik
MMRRC Submission 040254-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R2254 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location94214564-94317227 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 94227857 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079961] [ENSMUST00000109547] [ENSMUST00000212824]
Predicted Effect probably null
Transcript: ENSMUST00000079961
SMART Domains Protein: ENSMUSP00000078878
Gene: ENSMUSG00000032939

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 214 804 6.9e-198 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109547
SMART Domains Protein: ENSMUSP00000105174
Gene: ENSMUSG00000032939

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
Pfam:Nic96 202 804 8.2e-202 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212707
Predicted Effect probably null
Transcript: ENSMUST00000212824
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,222,905 C243F probably damaging Het
Actn2 T C 13: 12,296,479 E260G probably benign Het
AI429214 G T 8: 36,993,766 D23Y possibly damaging Het
Alms1 A G 6: 85,619,848 Y1021C probably damaging Het
Ang5 A G 14: 43,962,617 D46G probably benign Het
Ano9 T A 7: 141,103,090 D635V probably benign Het
Apob C T 12: 8,011,256 T3246I possibly damaging Het
Arhgef25 T C 10: 127,189,521 E63G probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Cdh2 A T 18: 16,643,928 probably null Het
Chmp7 C T 14: 69,720,956 V255I probably damaging Het
Dnhd1 T A 7: 105,703,772 S2711T probably damaging Het
Gabrg1 T A 5: 70,782,364 K137* probably null Het
Gdi2 T A 13: 3,554,400 probably null Het
Glyr1 A G 16: 5,019,013 V429A probably benign Het
Gm5938 T A X: 78,128,555 probably null Het
Golt1b T C 6: 142,396,253 L121P probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Ifi204 G A 1: 173,761,730 T45M possibly damaging Het
Il18r1 A G 1: 40,491,220 N369S possibly damaging Het
Kcnh1 G T 1: 192,505,414 probably null Het
Kitl G A 10: 100,080,131 probably null Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Lax1 A G 1: 133,680,233 S257P probably damaging Het
Lepr T C 4: 101,815,112 I1111T probably benign Het
Lrrcc1 G A 3: 14,547,255 R356H probably damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Med11 T C 11: 70,452,095 probably null Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Olfr610 A G 7: 103,506,064 V294A probably damaging Het
Ovch2 A G 7: 107,790,195 V342A probably benign Het
Ovgp1 A G 3: 105,986,912 probably benign Het
Oxtr A T 6: 112,489,106 L231Q probably damaging Het
Prap1 A G 7: 140,096,162 T30A probably damaging Het
Scg2 G A 1: 79,436,500 P169S probably damaging Het
Scube2 A G 7: 109,825,459 V549A possibly damaging Het
Slc22a12 A T 19: 6,542,541 V57D possibly damaging Het
Slc22a28 A C 19: 8,064,493 C450G probably benign Het
Tas2r120 A T 6: 132,657,609 Q218L probably benign Het
Tbx15 A G 3: 99,351,874 T354A possibly damaging Het
Trim24 A G 6: 37,958,677 T868A probably benign Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr20rt T A 12: 65,226,233 W56R probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp40 T C 17: 23,178,370 D51G possibly damaging Het
Zfp64 G A 2: 168,926,742 H317Y probably damaging Het
Other mutations in Nup93
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Nup93 APN 8 94309023 critical splice donor site probably null
IGL01652:Nup93 APN 8 94296559 missense possibly damaging 0.93
IGL02003:Nup93 APN 8 94302109 nonsense probably null
IGL02169:Nup93 APN 8 94302129 missense probably damaging 1.00
IGL02212:Nup93 APN 8 94311662 critical splice donor site probably null
IGL02551:Nup93 APN 8 94227833 nonsense probably null
IGL02568:Nup93 APN 8 94309635 missense probably damaging 1.00
IGL03094:Nup93 APN 8 94296502 missense probably benign
IGL03248:Nup93 APN 8 94306088 missense probably damaging 0.98
IGL03273:Nup93 APN 8 94306277 missense probably benign 0.01
IGL03401:Nup93 APN 8 94309711 splice site probably null
PIT4585001:Nup93 UTSW 8 94243727 missense probably benign 0.25
R0409:Nup93 UTSW 8 94303665 missense probably damaging 1.00
R0748:Nup93 UTSW 8 94307943 missense probably damaging 1.00
R0891:Nup93 UTSW 8 94281263 splice site probably benign
R1667:Nup93 UTSW 8 94292687 missense possibly damaging 0.71
R1696:Nup93 UTSW 8 94296555 missense probably benign 0.29
R1862:Nup93 UTSW 8 94306102 missense probably damaging 1.00
R2069:Nup93 UTSW 8 94243739 missense probably damaging 1.00
R2143:Nup93 UTSW 8 94296480 nonsense probably null
R2187:Nup93 UTSW 8 94300850 missense probably damaging 1.00
R2228:Nup93 UTSW 8 94304191 missense probably benign 0.27
R2229:Nup93 UTSW 8 94304191 missense probably benign 0.27
R2884:Nup93 UTSW 8 94303638 missense probably damaging 1.00
R4521:Nup93 UTSW 8 94314636 missense probably damaging 1.00
R4563:Nup93 UTSW 8 94307892 missense probably damaging 1.00
R4900:Nup93 UTSW 8 94286603 missense probably benign 0.25
R5570:Nup93 UTSW 8 94314670 missense probably damaging 1.00
R6226:Nup93 UTSW 8 94286537 missense probably damaging 1.00
R6489:Nup93 UTSW 8 94302088 missense probably benign 0.10
R6658:Nup93 UTSW 8 94304179 missense probably benign 0.02
R6817:Nup93 UTSW 8 94314682 critical splice donor site probably null
R6895:Nup93 UTSW 8 94243686 missense probably damaging 1.00
R6955:Nup93 UTSW 8 94309673 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAAGCAGAGATGAAGCCTCC -3'
(R):5'- AGACAAACAGGCTGGCACTC -3'

Sequencing Primer
(F):5'- CTGCATCTCTAATGGATACTGAGG -3'
(R):5'- GGCTGGCACTCTAAAAACCTAG -3'
Posted On2014-10-16