Incidental Mutation 'R2254:Mtmr2'
ID241881
Institutional Source Beutler Lab
Gene Symbol Mtmr2
Ensembl Gene ENSMUSG00000031918
Gene Namemyotubularin related protein 2
Synonyms6030445P13Rik
MMRRC Submission 040254-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R2254 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location13748410-13806481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13796057 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 230 (Y230H)
Ref Sequence ENSEMBL: ENSMUSP00000115906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034396] [ENSMUST00000134674] [ENSMUST00000152532] [ENSMUST00000155679]
Predicted Effect probably benign
Transcript: ENSMUST00000034396
AA Change: Y302H

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034396
Gene: ENSMUSG00000031918
AA Change: Y302H

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
GRAM 65 139 1.57e-11 SMART
Pfam:Myotub-related 192 529 1.7e-152 PFAM
low complexity region 616 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134674
SMART Domains Protein: ENSMUSP00000121933
Gene: ENSMUSG00000031918

DomainStartEndE-ValueType
PDB:1M7R|B 1 62 2e-9 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146901
Predicted Effect probably benign
Transcript: ENSMUST00000152532
SMART Domains Protein: ENSMUSP00000114509
Gene: ENSMUSG00000031918

DomainStartEndE-ValueType
GRAM 3 67 6.19e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000155679
AA Change: Y230H

PolyPhen 2 Score 0.492 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000115906
Gene: ENSMUSG00000031918
AA Change: Y230H

DomainStartEndE-ValueType
GRAM 3 67 6.19e-10 SMART
Pfam:Myotub-related 119 459 6.7e-152 PFAM
Pfam:Y_phosphatase 266 370 3.9e-6 PFAM
low complexity region 544 559 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myotubularin family of phosphoinositide lipid phosphatases. The encoded protein possesses phosphatase activity towards phosphatidylinositol-3-phosphate and phosphatidylinositol-3,5-bisphosphate. Mutations in this gene are a cause of Charcot-Marie-Tooth disease type 4B, an autosomal recessive demyelinating neuropathy. Alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mutants develop progressive neuropathy characterized by myelin outfolding and recurrent loops and depletion of spermatids and spermatocytes from the seminiferous epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,222,905 C243F probably damaging Het
Actn2 T C 13: 12,296,479 E260G probably benign Het
AI429214 G T 8: 36,993,766 D23Y possibly damaging Het
Alms1 A G 6: 85,619,848 Y1021C probably damaging Het
Ang5 A G 14: 43,962,617 D46G probably benign Het
Ano9 T A 7: 141,103,090 D635V probably benign Het
Apob C T 12: 8,011,256 T3246I possibly damaging Het
Arhgef25 T C 10: 127,189,521 E63G probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Cdh2 A T 18: 16,643,928 probably null Het
Chmp7 C T 14: 69,720,956 V255I probably damaging Het
Dnhd1 T A 7: 105,703,772 S2711T probably damaging Het
Gabrg1 T A 5: 70,782,364 K137* probably null Het
Gdi2 T A 13: 3,554,400 probably null Het
Glyr1 A G 16: 5,019,013 V429A probably benign Het
Gm5938 T A X: 78,128,555 probably null Het
Golt1b T C 6: 142,396,253 L121P probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Ifi204 G A 1: 173,761,730 T45M possibly damaging Het
Il18r1 A G 1: 40,491,220 N369S possibly damaging Het
Kcnh1 G T 1: 192,505,414 probably null Het
Kitl G A 10: 100,080,131 probably null Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Lax1 A G 1: 133,680,233 S257P probably damaging Het
Lepr T C 4: 101,815,112 I1111T probably benign Het
Lrrcc1 G A 3: 14,547,255 R356H probably damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Med11 T C 11: 70,452,095 probably null Het
Nup93 T C 8: 94,227,857 probably null Het
Olfr610 A G 7: 103,506,064 V294A probably damaging Het
Ovch2 A G 7: 107,790,195 V342A probably benign Het
Ovgp1 A G 3: 105,986,912 probably benign Het
Oxtr A T 6: 112,489,106 L231Q probably damaging Het
Prap1 A G 7: 140,096,162 T30A probably damaging Het
Scg2 G A 1: 79,436,500 P169S probably damaging Het
Scube2 A G 7: 109,825,459 V549A possibly damaging Het
Slc22a12 A T 19: 6,542,541 V57D possibly damaging Het
Slc22a28 A C 19: 8,064,493 C450G probably benign Het
Tas2r120 A T 6: 132,657,609 Q218L probably benign Het
Tbx15 A G 3: 99,351,874 T354A possibly damaging Het
Trim24 A G 6: 37,958,677 T868A probably benign Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr20rt T A 12: 65,226,233 W56R probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp40 T C 17: 23,178,370 D51G possibly damaging Het
Zfp64 G A 2: 168,926,742 H317Y probably damaging Het
Other mutations in Mtmr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Mtmr2 APN 9 13785916 missense probably benign 0.45
IGL01328:Mtmr2 APN 9 13801927 nonsense probably null
IGL02305:Mtmr2 APN 9 13795255 missense probably damaging 1.00
IGL03069:Mtmr2 APN 9 13793205 nonsense probably null
PIT4431001:Mtmr2 UTSW 9 13793179 missense probably benign 0.01
R0280:Mtmr2 UTSW 9 13799249 missense probably damaging 1.00
R0636:Mtmr2 UTSW 9 13801913 critical splice acceptor site probably null
R0831:Mtmr2 UTSW 9 13796113 missense probably damaging 0.99
R1202:Mtmr2 UTSW 9 13803452 missense probably benign
R1663:Mtmr2 UTSW 9 13803501 missense probably damaging 1.00
R1679:Mtmr2 UTSW 9 13789077 missense probably damaging 1.00
R2086:Mtmr2 UTSW 9 13799952 missense probably damaging 1.00
R2255:Mtmr2 UTSW 9 13796057 missense possibly damaging 0.49
R2932:Mtmr2 UTSW 9 13749117 unclassified probably benign
R4172:Mtmr2 UTSW 9 13800062 missense probably damaging 1.00
R4669:Mtmr2 UTSW 9 13795964 missense probably damaging 1.00
R5248:Mtmr2 UTSW 9 13783609 intron probably benign
R5317:Mtmr2 UTSW 9 13793179 missense probably benign 0.01
R5326:Mtmr2 UTSW 9 13788647 missense probably damaging 1.00
R5573:Mtmr2 UTSW 9 13793167 missense probably benign 0.15
R5830:Mtmr2 UTSW 9 13801978 missense probably benign 0.00
R6332:Mtmr2 UTSW 9 13800029 missense probably damaging 0.99
R6638:Mtmr2 UTSW 9 13796133 missense probably damaging 1.00
R6791:Mtmr2 UTSW 9 13805382 missense probably benign 0.02
R7072:Mtmr2 UTSW 9 13788620 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCCAGGCATCTGTATAGAG -3'
(R):5'- GCTTGCATAATCAACTCAGCAC -3'

Sequencing Primer
(F):5'- CAGGCATCTGTATAGAGACTGCTC -3'
(R):5'- ACTCAGCACAATATGATCTCTGTC -3'
Posted On2014-10-16