Incidental Mutation 'R2254:Bmper'
ID241882
Institutional Source Beutler Lab
Gene Symbol Bmper
Ensembl Gene ENSMUSG00000031963
Gene NameBMP-binding endothelial regulator
SynonymsCV-2, Crim3, 3110056H04Rik, crossveinless-2, Cv2
MMRRC Submission 040254-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2254 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location23223076-23485200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23381463 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 356 (I356N)
Ref Sequence ENSEMBL: ENSMUSP00000071872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071982]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071982
AA Change: I356N

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071872
Gene: ENSMUSG00000031963
AA Change: I356N

DomainStartEndE-ValueType
VWC 50 105 1.57e-2 SMART
VWC 108 163 1.89e-1 SMART
VWC 166 224 7.27e-7 SMART
VWC 238 289 3.34e-6 SMART
VWC 301 357 1.7e-7 SMART
VWD 355 513 3.75e-41 SMART
C8 553 625 1.07e-14 SMART
Pfam:TIL 629 682 2.5e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000214050
AA Change: I97N
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted protein that contains five Von Willebrand factor type C domains and a Von Willebrand factor type D domain and a trypsin inhibitory-like domain. The encoded protein binds to bone morphogenetic proteins (BMP) and regulates their activity. Mutation of the related gene in humans causes diaphanospondylodysostosis. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a knock-out mutation exhibit neonatal lethality associated with abnormal lung and skeleton development. Mice heterozygous for a null allele exhibit abnromal lung development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,222,905 C243F probably damaging Het
Actn2 T C 13: 12,296,479 E260G probably benign Het
AI429214 G T 8: 36,993,766 D23Y possibly damaging Het
Alms1 A G 6: 85,619,848 Y1021C probably damaging Het
Ang5 A G 14: 43,962,617 D46G probably benign Het
Ano9 T A 7: 141,103,090 D635V probably benign Het
Apob C T 12: 8,011,256 T3246I possibly damaging Het
Arhgef25 T C 10: 127,189,521 E63G probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Cdh2 A T 18: 16,643,928 probably null Het
Chmp7 C T 14: 69,720,956 V255I probably damaging Het
Dnhd1 T A 7: 105,703,772 S2711T probably damaging Het
Gabrg1 T A 5: 70,782,364 K137* probably null Het
Gdi2 T A 13: 3,554,400 probably null Het
Glyr1 A G 16: 5,019,013 V429A probably benign Het
Gm5938 T A X: 78,128,555 probably null Het
Golt1b T C 6: 142,396,253 L121P probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Ifi204 G A 1: 173,761,730 T45M possibly damaging Het
Il18r1 A G 1: 40,491,220 N369S possibly damaging Het
Kcnh1 G T 1: 192,505,414 probably null Het
Kitl G A 10: 100,080,131 probably null Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Lax1 A G 1: 133,680,233 S257P probably damaging Het
Lepr T C 4: 101,815,112 I1111T probably benign Het
Lrrcc1 G A 3: 14,547,255 R356H probably damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Med11 T C 11: 70,452,095 probably null Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nup93 T C 8: 94,227,857 probably null Het
Olfr610 A G 7: 103,506,064 V294A probably damaging Het
Ovch2 A G 7: 107,790,195 V342A probably benign Het
Ovgp1 A G 3: 105,986,912 probably benign Het
Oxtr A T 6: 112,489,106 L231Q probably damaging Het
Prap1 A G 7: 140,096,162 T30A probably damaging Het
Scg2 G A 1: 79,436,500 P169S probably damaging Het
Scube2 A G 7: 109,825,459 V549A possibly damaging Het
Slc22a12 A T 19: 6,542,541 V57D possibly damaging Het
Slc22a28 A C 19: 8,064,493 C450G probably benign Het
Tas2r120 A T 6: 132,657,609 Q218L probably benign Het
Tbx15 A G 3: 99,351,874 T354A possibly damaging Het
Trim24 A G 6: 37,958,677 T868A probably benign Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr20rt T A 12: 65,226,233 W56R probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp40 T C 17: 23,178,370 D51G possibly damaging Het
Zfp64 G A 2: 168,926,742 H317Y probably damaging Het
Other mutations in Bmper
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Bmper APN 9 23406527 missense probably damaging 1.00
IGL00576:Bmper APN 9 23406603 missense probably damaging 1.00
IGL01115:Bmper APN 9 23399689 intron probably benign
IGL01978:Bmper APN 9 23381441 missense probably damaging 1.00
IGL02950:Bmper APN 9 23399494 missense probably damaging 1.00
IGL03193:Bmper APN 9 23366248 missense possibly damaging 0.46
PIT4469001:Bmper UTSW 9 23406549 missense probably benign 0.00
PIT4531001:Bmper UTSW 9 23224817 missense possibly damaging 0.90
R0047:Bmper UTSW 9 23406686 missense probably damaging 1.00
R0047:Bmper UTSW 9 23406686 missense probably damaging 1.00
R0173:Bmper UTSW 9 23224829 missense probably benign 0.02
R0504:Bmper UTSW 9 23406687 missense probably damaging 1.00
R0550:Bmper UTSW 9 23373885 missense probably benign 0.01
R0722:Bmper UTSW 9 23373928 missense probably benign 0.00
R2255:Bmper UTSW 9 23381463 missense possibly damaging 0.81
R2863:Bmper UTSW 9 23483941 missense probably benign
R2865:Bmper UTSW 9 23483941 missense probably benign
R3841:Bmper UTSW 9 23473431 splice site probably null
R4056:Bmper UTSW 9 23399629 missense probably benign
R4105:Bmper UTSW 9 23224763 missense probably benign 0.00
R4108:Bmper UTSW 9 23224763 missense probably benign 0.00
R4352:Bmper UTSW 9 23483952 missense probably benign
R4824:Bmper UTSW 9 23223660 missense possibly damaging 0.77
R4909:Bmper UTSW 9 23377725 missense probably benign 0.07
R5356:Bmper UTSW 9 23373861 missense probably benign 0.01
R5379:Bmper UTSW 9 23297224 missense probably benign 0.42
R5666:Bmper UTSW 9 23473463 missense probably damaging 1.00
R5670:Bmper UTSW 9 23473463 missense probably damaging 1.00
R5883:Bmper UTSW 9 23406674 missense probably benign 0.28
R5963:Bmper UTSW 9 23375593 missense probably benign 0.03
R6312:Bmper UTSW 9 23406791 missense possibly damaging 0.46
R6768:Bmper UTSW 9 23381453 missense probably damaging 1.00
R6897:Bmper UTSW 9 23373929 missense probably benign 0.01
R6907:Bmper UTSW 9 23399572 missense probably damaging 1.00
R7220:Bmper UTSW 9 23399355 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAAAACTTCTGGAGTGATCTTG -3'
(R):5'- AGAGGATGGCAGCTGATACC -3'

Sequencing Primer
(F):5'- GGACACCTGATGCATTTCAC -3'
(R):5'- ATGGCAGCTGATACCGGGTAC -3'
Posted On2014-10-16