Incidental Mutation 'R2254:Upb1'
ID241883
Institutional Source Beutler Lab
Gene Symbol Upb1
Ensembl Gene ENSMUSG00000033427
Gene Nameureidopropionase, beta
Synonyms
MMRRC Submission 040254-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R2254 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location75401115-75441679 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75436217 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 288 (R288H)
Ref Sequence ENSEMBL: ENSMUSP00000049342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039925] [ENSMUST00000145890]
Predicted Effect probably damaging
Transcript: ENSMUST00000039925
AA Change: R288H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049342
Gene: ENSMUSG00000033427
AA Change: R288H

DomainStartEndE-ValueType
Pfam:CN_hydrolase 73 352 8.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145890
SMART Domains Protein: ENSMUSP00000123254
Gene: ENSMUSG00000033416

DomainStartEndE-ValueType
Pfam:Peptidase_C39_2 20 206 2.6e-10 PFAM
Pfam:Guanylate_cyc_2 22 210 4e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153125
SMART Domains Protein: ENSMUSP00000117061
Gene: ENSMUSG00000033416

DomainStartEndE-ValueType
Pfam:Guanylate_cyc_2 2 91 2.3e-35 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that catalyzes the conversion of N-carbamyl-beta-aminoisobutyric acid and N-carbamyl-beta-alanine to beta-aminoisobutyric acid or beta-alanine. Mutations in the related gene in human have been associated with beta-ureidopropionase deficiency. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,222,905 C243F probably damaging Het
Actn2 T C 13: 12,296,479 E260G probably benign Het
AI429214 G T 8: 36,993,766 D23Y possibly damaging Het
Alms1 A G 6: 85,619,848 Y1021C probably damaging Het
Ang5 A G 14: 43,962,617 D46G probably benign Het
Ano9 T A 7: 141,103,090 D635V probably benign Het
Apob C T 12: 8,011,256 T3246I possibly damaging Het
Arhgef25 T C 10: 127,189,521 E63G probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Cdh2 A T 18: 16,643,928 probably null Het
Chmp7 C T 14: 69,720,956 V255I probably damaging Het
Dnhd1 T A 7: 105,703,772 S2711T probably damaging Het
Gabrg1 T A 5: 70,782,364 K137* probably null Het
Gdi2 T A 13: 3,554,400 probably null Het
Glyr1 A G 16: 5,019,013 V429A probably benign Het
Gm5938 T A X: 78,128,555 probably null Het
Golt1b T C 6: 142,396,253 L121P probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Ifi204 G A 1: 173,761,730 T45M possibly damaging Het
Il18r1 A G 1: 40,491,220 N369S possibly damaging Het
Kcnh1 G T 1: 192,505,414 probably null Het
Kitl G A 10: 100,080,131 probably null Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Lax1 A G 1: 133,680,233 S257P probably damaging Het
Lepr T C 4: 101,815,112 I1111T probably benign Het
Lrrcc1 G A 3: 14,547,255 R356H probably damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Med11 T C 11: 70,452,095 probably null Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nup93 T C 8: 94,227,857 probably null Het
Olfr610 A G 7: 103,506,064 V294A probably damaging Het
Ovch2 A G 7: 107,790,195 V342A probably benign Het
Ovgp1 A G 3: 105,986,912 probably benign Het
Oxtr A T 6: 112,489,106 L231Q probably damaging Het
Prap1 A G 7: 140,096,162 T30A probably damaging Het
Scg2 G A 1: 79,436,500 P169S probably damaging Het
Scube2 A G 7: 109,825,459 V549A possibly damaging Het
Slc22a12 A T 19: 6,542,541 V57D possibly damaging Het
Slc22a28 A C 19: 8,064,493 C450G probably benign Het
Tas2r120 A T 6: 132,657,609 Q218L probably benign Het
Tbx15 A G 3: 99,351,874 T354A possibly damaging Het
Trim24 A G 6: 37,958,677 T868A probably benign Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Wdr20rt T A 12: 65,226,233 W56R probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp40 T C 17: 23,178,370 D51G possibly damaging Het
Zfp64 G A 2: 168,926,742 H317Y probably damaging Het
Other mutations in Upb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0419:Upb1 UTSW 10 75412883 missense probably damaging 1.00
R0450:Upb1 UTSW 10 75415083 splice site probably null
R0469:Upb1 UTSW 10 75415083 splice site probably null
R0565:Upb1 UTSW 10 75428354 unclassified probably benign
R1109:Upb1 UTSW 10 75438165 missense probably damaging 1.00
R1439:Upb1 UTSW 10 75439942 missense probably benign
R2001:Upb1 UTSW 10 75429969 missense probably damaging 1.00
R2074:Upb1 UTSW 10 75424513 missense probably damaging 1.00
R2255:Upb1 UTSW 10 75436217 missense probably damaging 1.00
R3773:Upb1 UTSW 10 75439838 intron probably null
R4696:Upb1 UTSW 10 75415027 missense probably benign 0.22
R5157:Upb1 UTSW 10 75412804 missense possibly damaging 0.78
R5723:Upb1 UTSW 10 75428271 missense probably damaging 0.99
R6292:Upb1 UTSW 10 75438171 missense probably damaging 1.00
R6335:Upb1 UTSW 10 75428301 missense probably benign 0.09
R6577:Upb1 UTSW 10 75412889 missense probably damaging 1.00
R6756:Upb1 UTSW 10 75428301 missense possibly damaging 0.78
R6765:Upb1 UTSW 10 75438144 missense probably damaging 1.00
R7069:Upb1 UTSW 10 75412768 missense probably benign 0.00
R7094:Upb1 UTSW 10 75438208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTACCATGCCCAGTTCTG -3'
(R):5'- ACCCTGTCCGTGGAAATAAC -3'

Sequencing Primer
(F):5'- AGTTCTGCTCGCAGCCTG -3'
(R):5'- TGTCCGTGGAAATAACACCTC -3'
Posted On2014-10-16