Incidental Mutation 'R2254:Krt33a'
ID241888
Institutional Source Beutler Lab
Gene Symbol Krt33a
Ensembl Gene ENSMUSG00000035592
Gene Namekeratin 33A
Synonyms2310015J09Rik
MMRRC Submission 040254-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R2254 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100011195-100016212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100014178 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 167 (D167E)
Ref Sequence ENSEMBL: ENSMUSP00000018399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018399]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018399
AA Change: D167E

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000018399
Gene: ENSMUSG00000035592
AA Change: D167E

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
Filament 55 366 1.99e-148 SMART
internal_repeat_1 368 385 6.11e-5 PROSPERO
internal_repeat_1 384 399 6.11e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138756
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations of this gene cause the hair coat to appear either shiny, reflective and "polished" or greasy looking, disheveled and "spikey." [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,222,905 C243F probably damaging Het
Actn2 T C 13: 12,296,479 E260G probably benign Het
AI429214 G T 8: 36,993,766 D23Y possibly damaging Het
Alms1 A G 6: 85,619,848 Y1021C probably damaging Het
Ang5 A G 14: 43,962,617 D46G probably benign Het
Ano9 T A 7: 141,103,090 D635V probably benign Het
Apob C T 12: 8,011,256 T3246I possibly damaging Het
Arhgef25 T C 10: 127,189,521 E63G probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Cdh2 A T 18: 16,643,928 probably null Het
Chmp7 C T 14: 69,720,956 V255I probably damaging Het
Dnhd1 T A 7: 105,703,772 S2711T probably damaging Het
Gabrg1 T A 5: 70,782,364 K137* probably null Het
Gdi2 T A 13: 3,554,400 probably null Het
Glyr1 A G 16: 5,019,013 V429A probably benign Het
Gm5938 T A X: 78,128,555 probably null Het
Golt1b T C 6: 142,396,253 L121P probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Ifi204 G A 1: 173,761,730 T45M possibly damaging Het
Il18r1 A G 1: 40,491,220 N369S possibly damaging Het
Kcnh1 G T 1: 192,505,414 probably null Het
Kitl G A 10: 100,080,131 probably null Het
Lax1 A G 1: 133,680,233 S257P probably damaging Het
Lepr T C 4: 101,815,112 I1111T probably benign Het
Lrrcc1 G A 3: 14,547,255 R356H probably damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Med11 T C 11: 70,452,095 probably null Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nup93 T C 8: 94,227,857 probably null Het
Olfr610 A G 7: 103,506,064 V294A probably damaging Het
Ovch2 A G 7: 107,790,195 V342A probably benign Het
Ovgp1 A G 3: 105,986,912 probably benign Het
Oxtr A T 6: 112,489,106 L231Q probably damaging Het
Prap1 A G 7: 140,096,162 T30A probably damaging Het
Scg2 G A 1: 79,436,500 P169S probably damaging Het
Scube2 A G 7: 109,825,459 V549A possibly damaging Het
Slc22a12 A T 19: 6,542,541 V57D possibly damaging Het
Slc22a28 A C 19: 8,064,493 C450G probably benign Het
Tas2r120 A T 6: 132,657,609 Q218L probably benign Het
Tbx15 A G 3: 99,351,874 T354A possibly damaging Het
Trim24 A G 6: 37,958,677 T868A probably benign Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr20rt T A 12: 65,226,233 W56R probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp40 T C 17: 23,178,370 D51G possibly damaging Het
Zfp64 G A 2: 168,926,742 H317Y probably damaging Het
Other mutations in Krt33a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01803:Krt33a APN 11 100012017 missense probably benign 0.35
IGL02412:Krt33a APN 11 100011979 missense probably benign 0.01
IGL02523:Krt33a APN 11 100011692 missense probably benign 0.02
Polished UTSW 11 100012611 missense probably damaging 1.00
Polished2 UTSW 11 100015850 missense probably benign 0.10
Spikey UTSW 11 100011939 missense probably damaging 1.00
R0492:Krt33a UTSW 11 100016083 missense probably benign 0.02
R0496:Krt33a UTSW 11 100012329 splice site probably benign
R0691:Krt33a UTSW 11 100012715 missense probably damaging 1.00
R1077:Krt33a UTSW 11 100015937 missense probably benign
R1624:Krt33a UTSW 11 100014246 missense probably damaging 1.00
R1911:Krt33a UTSW 11 100012349 missense probably benign 0.35
R1944:Krt33a UTSW 11 100012709 missense probably benign 0.10
R1945:Krt33a UTSW 11 100012709 missense probably benign 0.10
R2255:Krt33a UTSW 11 100014178 missense possibly damaging 0.95
R3716:Krt33a UTSW 11 100014165 missense probably benign 0.01
R4377:Krt33a UTSW 11 100012427 missense possibly damaging 0.46
R5233:Krt33a UTSW 11 100014135 missense probably damaging 1.00
R6029:Krt33a UTSW 11 100012463 missense probably benign 0.01
R6316:Krt33a UTSW 11 100014201 missense probably damaging 0.98
R6807:Krt33a UTSW 11 100012383 missense possibly damaging 0.61
R7272:Krt33a UTSW 11 100012011 missense probably damaging 1.00
R7323:Krt33a UTSW 11 100011975 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTGAGCCTCAACTCACAGC -3'
(R):5'- GACCTACTTCTGGATCTTGACAAC -3'

Sequencing Primer
(F):5'- GAGCCTCAACTCACAGCCTCTC -3'
(R):5'- TGGATCTTGACAACTTAAATAGAAGG -3'
Posted On2014-10-16