Incidental Mutation 'R2254:Gdi2'
ID241893
Institutional Source Beutler Lab
Gene Symbol Gdi2
Ensembl Gene ENSMUSG00000021218
Gene Nameguanosine diphosphate (GDP) dissociation inhibitor 2
SynonymsGDIB, Gdi3, GDI beta, GDI-B
MMRRC Submission 040254-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2254 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location3538063-3567871 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 3554400 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059515] [ENSMUST00000222365] [ENSMUST00000223396]
Predicted Effect probably null
Transcript: ENSMUST00000059515
SMART Domains Protein: ENSMUSP00000062996
Gene: ENSMUSG00000021218

DomainStartEndE-ValueType
Pfam:GDI 1 436 4.6e-239 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221875
Predicted Effect probably benign
Transcript: ENSMUST00000222365
Predicted Effect probably null
Transcript: ENSMUST00000223396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223501
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GDP dissociation inhibitors are proteins that regulate the GDP-GTP exchange reaction of members of the rab family, small GTP-binding proteins of the ras superfamily, that are involved in vesicular trafficking of molecules between cellular organelles. GDIs slow the rate of dissociation of GDP from rab proteins and release GDP from membrane-bound rabs. GDI2 is ubiquitously expressed. The GDI2 gene contains many repetitive elements indicating that it may be prone to inversion/deletion rearrangements. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,222,905 C243F probably damaging Het
Actn2 T C 13: 12,296,479 E260G probably benign Het
AI429214 G T 8: 36,993,766 D23Y possibly damaging Het
Alms1 A G 6: 85,619,848 Y1021C probably damaging Het
Ang5 A G 14: 43,962,617 D46G probably benign Het
Ano9 T A 7: 141,103,090 D635V probably benign Het
Apob C T 12: 8,011,256 T3246I possibly damaging Het
Arhgef25 T C 10: 127,189,521 E63G probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Cdh2 A T 18: 16,643,928 probably null Het
Chmp7 C T 14: 69,720,956 V255I probably damaging Het
Dnhd1 T A 7: 105,703,772 S2711T probably damaging Het
Gabrg1 T A 5: 70,782,364 K137* probably null Het
Glyr1 A G 16: 5,019,013 V429A probably benign Het
Gm5938 T A X: 78,128,555 probably null Het
Golt1b T C 6: 142,396,253 L121P probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Ifi204 G A 1: 173,761,730 T45M possibly damaging Het
Il18r1 A G 1: 40,491,220 N369S possibly damaging Het
Kcnh1 G T 1: 192,505,414 probably null Het
Kitl G A 10: 100,080,131 probably null Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Lax1 A G 1: 133,680,233 S257P probably damaging Het
Lepr T C 4: 101,815,112 I1111T probably benign Het
Lrrcc1 G A 3: 14,547,255 R356H probably damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Med11 T C 11: 70,452,095 probably null Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nup93 T C 8: 94,227,857 probably null Het
Olfr610 A G 7: 103,506,064 V294A probably damaging Het
Ovch2 A G 7: 107,790,195 V342A probably benign Het
Ovgp1 A G 3: 105,986,912 probably benign Het
Oxtr A T 6: 112,489,106 L231Q probably damaging Het
Prap1 A G 7: 140,096,162 T30A probably damaging Het
Scg2 G A 1: 79,436,500 P169S probably damaging Het
Scube2 A G 7: 109,825,459 V549A possibly damaging Het
Slc22a12 A T 19: 6,542,541 V57D possibly damaging Het
Slc22a28 A C 19: 8,064,493 C450G probably benign Het
Tas2r120 A T 6: 132,657,609 Q218L probably benign Het
Tbx15 A G 3: 99,351,874 T354A possibly damaging Het
Trim24 A G 6: 37,958,677 T868A probably benign Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr20rt T A 12: 65,226,233 W56R probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp40 T C 17: 23,178,370 D51G possibly damaging Het
Zfp64 G A 2: 168,926,742 H317Y probably damaging Het
Other mutations in Gdi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Gdi2 APN 13 3556467 missense probably benign 0.04
IGL01135:Gdi2 APN 13 3548855 splice site probably benign
IGL01402:Gdi2 APN 13 3564611 missense probably benign 0.24
IGL01404:Gdi2 APN 13 3564611 missense probably benign 0.24
IGL02100:Gdi2 APN 13 3556373 missense probably benign 0.03
IGL02305:Gdi2 APN 13 3556428 missense probably damaging 1.00
IGL02545:Gdi2 APN 13 3557009 missense probably damaging 1.00
IGL02561:Gdi2 APN 13 3548954 missense possibly damaging 0.94
IGL02939:Gdi2 APN 13 3564623 missense probably benign 0.21
E0354:Gdi2 UTSW 13 3561939 unclassified probably null
R1612:Gdi2 UTSW 13 3560051 missense probably benign 0.00
R1775:Gdi2 UTSW 13 3560018 missense possibly damaging 0.71
R1803:Gdi2 UTSW 13 3564547 nonsense probably null
R2426:Gdi2 UTSW 13 3562034 missense probably benign 0.17
R4081:Gdi2 UTSW 13 3548866 missense probably benign 0.10
R6365:Gdi2 UTSW 13 3565093 missense possibly damaging 0.82
R7130:Gdi2 UTSW 13 3548891 missense probably benign 0.12
R7268:Gdi2 UTSW 13 3556363 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTACAAGTTGTAGCACTGACC -3'
(R):5'- ATGGATGTCTGTGATTCCTTTTCAC -3'

Sequencing Primer
(F):5'- CTACAAGTTGTAGCACTGACCTTCAG -3'
(R):5'- TCACCAGAAAAATCTCATCATTGTG -3'
Posted On2014-10-16