Incidental Mutation 'R2254:Glyr1'
ID241898
Institutional Source Beutler Lab
Gene Symbol Glyr1
Ensembl Gene ENSMUSG00000022536
Gene Nameglyoxylate reductase 1 homolog (Arabidopsis)
Synonyms3930401K13Rik, Npac, 2810419J22Rik
MMRRC Submission 040254-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.321) question?
Stock #R2254 (G1)
Quality Score203
Status Not validated
Chromosome16
Chromosomal Location5013909-5049863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5019013 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 429 (V429A)
Ref Sequence ENSEMBL: ENSMUSP00000111510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023189] [ENSMUST00000115844]
Predicted Effect probably benign
Transcript: ENSMUST00000023189
AA Change: V423A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023189
Gene: ENSMUSG00000022536
AA Change: V423A

DomainStartEndE-ValueType
Pfam:PWWP 6 89 1.4e-24 PFAM
low complexity region 109 122 N/A INTRINSIC
AT_hook 167 179 3.21e-1 SMART
Pfam:NAD_binding_2 266 422 1.2e-36 PFAM
Pfam:F420_oxidored 268 355 2e-6 PFAM
Pfam:NAD_binding_11 423 544 2.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115844
AA Change: V429A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000111510
Gene: ENSMUSG00000022536
AA Change: V429A

DomainStartEndE-ValueType
Pfam:PWWP 6 89 1.8e-24 PFAM
low complexity region 109 122 N/A INTRINSIC
AT_hook 167 179 3.21e-1 SMART
Pfam:NAD_binding_2 266 428 2.6e-41 PFAM
Pfam:F420_oxidored 268 361 3.2e-9 PFAM
Pfam:NAD_binding_11 429 550 3.4e-25 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,222,905 C243F probably damaging Het
Actn2 T C 13: 12,296,479 E260G probably benign Het
AI429214 G T 8: 36,993,766 D23Y possibly damaging Het
Alms1 A G 6: 85,619,848 Y1021C probably damaging Het
Ang5 A G 14: 43,962,617 D46G probably benign Het
Ano9 T A 7: 141,103,090 D635V probably benign Het
Apob C T 12: 8,011,256 T3246I possibly damaging Het
Arhgef25 T C 10: 127,189,521 E63G probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Cdh2 A T 18: 16,643,928 probably null Het
Chmp7 C T 14: 69,720,956 V255I probably damaging Het
Dnhd1 T A 7: 105,703,772 S2711T probably damaging Het
Gabrg1 T A 5: 70,782,364 K137* probably null Het
Gdi2 T A 13: 3,554,400 probably null Het
Gm5938 T A X: 78,128,555 probably null Het
Golt1b T C 6: 142,396,253 L121P probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Ifi204 G A 1: 173,761,730 T45M possibly damaging Het
Il18r1 A G 1: 40,491,220 N369S possibly damaging Het
Kcnh1 G T 1: 192,505,414 probably null Het
Kitl G A 10: 100,080,131 probably null Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Lax1 A G 1: 133,680,233 S257P probably damaging Het
Lepr T C 4: 101,815,112 I1111T probably benign Het
Lrrcc1 G A 3: 14,547,255 R356H probably damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Med11 T C 11: 70,452,095 probably null Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nup93 T C 8: 94,227,857 probably null Het
Olfr610 A G 7: 103,506,064 V294A probably damaging Het
Ovch2 A G 7: 107,790,195 V342A probably benign Het
Ovgp1 A G 3: 105,986,912 probably benign Het
Oxtr A T 6: 112,489,106 L231Q probably damaging Het
Prap1 A G 7: 140,096,162 T30A probably damaging Het
Scg2 G A 1: 79,436,500 P169S probably damaging Het
Scube2 A G 7: 109,825,459 V549A possibly damaging Het
Slc22a12 A T 19: 6,542,541 V57D possibly damaging Het
Slc22a28 A C 19: 8,064,493 C450G probably benign Het
Tas2r120 A T 6: 132,657,609 Q218L probably benign Het
Tbx15 A G 3: 99,351,874 T354A possibly damaging Het
Trim24 A G 6: 37,958,677 T868A probably benign Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr20rt T A 12: 65,226,233 W56R probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp40 T C 17: 23,178,370 D51G possibly damaging Het
Zfp64 G A 2: 168,926,742 H317Y probably damaging Het
Other mutations in Glyr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Glyr1 APN 16 5020288 missense probably benign
IGL02332:Glyr1 APN 16 5018953 missense probably damaging 1.00
IGL02407:Glyr1 APN 16 5036948 missense probably benign 0.01
IGL02429:Glyr1 APN 16 5019376 missense probably benign 0.28
IGL03255:Glyr1 APN 16 5048757 unclassified probably null
R0020:Glyr1 UTSW 16 5037049 missense probably damaging 1.00
R0309:Glyr1 UTSW 16 5031972 missense probably damaging 0.98
R0694:Glyr1 UTSW 16 5026560 missense probably damaging 0.99
R0971:Glyr1 UTSW 16 5021345 frame shift probably null
R1347:Glyr1 UTSW 16 5021339 missense probably damaging 1.00
R1347:Glyr1 UTSW 16 5021339 missense probably damaging 1.00
R1382:Glyr1 UTSW 16 5021345 frame shift probably null
R1383:Glyr1 UTSW 16 5021345 frame shift probably null
R2137:Glyr1 UTSW 16 5018482 missense probably benign 0.01
R3913:Glyr1 UTSW 16 5031913 missense probably damaging 1.00
R4112:Glyr1 UTSW 16 5018486 missense possibly damaging 0.83
R4629:Glyr1 UTSW 16 5037043 missense possibly damaging 0.70
R4795:Glyr1 UTSW 16 5047758 missense probably benign 0.40
R5112:Glyr1 UTSW 16 5018876 nonsense probably null
R5412:Glyr1 UTSW 16 5036433 missense possibly damaging 0.87
R5757:Glyr1 UTSW 16 5018992 missense probably benign 0.30
R6425:Glyr1 UTSW 16 5036486 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTTTGGCACTTCTGGTCCAG -3'
(R):5'- GGACTAAAGGCTTGCAGGTG -3'

Sequencing Primer
(F):5'- GAAAGATGCTGGCCAATTGTCCC -3'
(R):5'- ATTGGTGACAGTGTCAGTCCCAC -3'
Posted On2014-10-16