Incidental Mutation 'R2254:Zfp40'
ID241899
Institutional Source Beutler Lab
Gene Symbol Zfp40
Ensembl Gene ENSMUSG00000002617
Gene Namezinc finger protein 40
SynonymsNTfin12, Zfp-40
MMRRC Submission 040254-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R2254 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location23173869-23193252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23178370 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 51 (D51G)
Ref Sequence ENSEMBL: ENSMUSP00000128758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037057] [ENSMUST00000140313] [ENSMUST00000172177]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037057
AA Change: D51G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039794
Gene: ENSMUSG00000002617
AA Change: D51G

DomainStartEndE-ValueType
KRAB 43 103 2.96e-17 SMART
ZnF_C2H2 225 247 1.47e-3 SMART
ZnF_C2H2 281 302 5.77e0 SMART
ZnF_C2H2 308 330 4.34e0 SMART
ZnF_C2H2 336 358 1.82e-3 SMART
ZnF_C2H2 363 385 4.24e-4 SMART
ZnF_C2H2 391 413 2.75e-3 SMART
ZnF_C2H2 419 441 1.38e-3 SMART
ZnF_C2H2 447 469 9.58e-3 SMART
ZnF_C2H2 475 497 1.47e-3 SMART
ZnF_C2H2 503 525 8.47e-4 SMART
ZnF_C2H2 531 553 2.57e-3 SMART
ZnF_C2H2 559 581 8.47e-4 SMART
ZnF_C2H2 587 609 4.54e-4 SMART
ZnF_C2H2 615 636 1.26e1 SMART
ZnF_C2H2 642 664 5.59e-4 SMART
ZnF_C2H2 670 692 3.21e-4 SMART
ZnF_C2H2 698 720 2.24e-3 SMART
ZnF_C2H2 726 748 1.2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135840
Predicted Effect probably benign
Transcript: ENSMUST00000140313
SMART Domains Protein: ENSMUSP00000121359
Gene: ENSMUSG00000002617

DomainStartEndE-ValueType
Blast:KRAB 1 35 4e-16 BLAST
ZnF_C2H2 157 179 1.47e-3 SMART
ZnF_C2H2 213 234 5.77e0 SMART
ZnF_C2H2 240 262 4.34e0 SMART
ZnF_C2H2 268 290 1.82e-3 SMART
ZnF_C2H2 295 317 4.24e-4 SMART
ZnF_C2H2 323 345 2.75e-3 SMART
ZnF_C2H2 351 373 1.38e-3 SMART
ZnF_C2H2 379 401 9.58e-3 SMART
ZnF_C2H2 407 429 1.47e-3 SMART
ZnF_C2H2 435 457 8.47e-4 SMART
ZnF_C2H2 463 485 2.57e-3 SMART
ZnF_C2H2 491 513 8.47e-4 SMART
ZnF_C2H2 519 541 4.54e-4 SMART
ZnF_C2H2 547 568 1.26e1 SMART
ZnF_C2H2 574 596 5.59e-4 SMART
ZnF_C2H2 602 624 3.21e-4 SMART
ZnF_C2H2 630 652 2.24e-3 SMART
ZnF_C2H2 658 680 1.2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142999
Predicted Effect possibly damaging
Transcript: ENSMUST00000172177
AA Change: D51G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128758
Gene: ENSMUSG00000002617
AA Change: D51G

DomainStartEndE-ValueType
KRAB 43 103 2.96e-17 SMART
ZnF_C2H2 225 247 1.47e-3 SMART
ZnF_C2H2 281 302 5.77e0 SMART
ZnF_C2H2 308 330 4.34e0 SMART
ZnF_C2H2 336 358 1.82e-3 SMART
ZnF_C2H2 363 385 4.24e-4 SMART
ZnF_C2H2 391 413 2.75e-3 SMART
ZnF_C2H2 419 441 1.38e-3 SMART
ZnF_C2H2 447 469 9.58e-3 SMART
ZnF_C2H2 475 497 1.47e-3 SMART
ZnF_C2H2 503 525 8.47e-4 SMART
ZnF_C2H2 531 553 2.57e-3 SMART
ZnF_C2H2 559 581 8.47e-4 SMART
ZnF_C2H2 587 609 4.54e-4 SMART
ZnF_C2H2 615 636 1.26e1 SMART
ZnF_C2H2 642 664 5.59e-4 SMART
ZnF_C2H2 670 692 3.21e-4 SMART
ZnF_C2H2 698 720 2.24e-3 SMART
ZnF_C2H2 726 748 1.2e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik G T 7: 131,222,905 C243F probably damaging Het
Actn2 T C 13: 12,296,479 E260G probably benign Het
AI429214 G T 8: 36,993,766 D23Y possibly damaging Het
Alms1 A G 6: 85,619,848 Y1021C probably damaging Het
Ang5 A G 14: 43,962,617 D46G probably benign Het
Ano9 T A 7: 141,103,090 D635V probably benign Het
Apob C T 12: 8,011,256 T3246I possibly damaging Het
Arhgef25 T C 10: 127,189,521 E63G probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Cdh2 A T 18: 16,643,928 probably null Het
Chmp7 C T 14: 69,720,956 V255I probably damaging Het
Dnhd1 T A 7: 105,703,772 S2711T probably damaging Het
Gabrg1 T A 5: 70,782,364 K137* probably null Het
Gdi2 T A 13: 3,554,400 probably null Het
Glyr1 A G 16: 5,019,013 V429A probably benign Het
Gm5938 T A X: 78,128,555 probably null Het
Golt1b T C 6: 142,396,253 L121P probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Ifi204 G A 1: 173,761,730 T45M possibly damaging Het
Il18r1 A G 1: 40,491,220 N369S possibly damaging Het
Kcnh1 G T 1: 192,505,414 probably null Het
Kitl G A 10: 100,080,131 probably null Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Lax1 A G 1: 133,680,233 S257P probably damaging Het
Lepr T C 4: 101,815,112 I1111T probably benign Het
Lrrcc1 G A 3: 14,547,255 R356H probably damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Med11 T C 11: 70,452,095 probably null Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nup93 T C 8: 94,227,857 probably null Het
Olfr610 A G 7: 103,506,064 V294A probably damaging Het
Ovch2 A G 7: 107,790,195 V342A probably benign Het
Ovgp1 A G 3: 105,986,912 probably benign Het
Oxtr A T 6: 112,489,106 L231Q probably damaging Het
Prap1 A G 7: 140,096,162 T30A probably damaging Het
Scg2 G A 1: 79,436,500 P169S probably damaging Het
Scube2 A G 7: 109,825,459 V549A possibly damaging Het
Slc22a12 A T 19: 6,542,541 V57D possibly damaging Het
Slc22a28 A C 19: 8,064,493 C450G probably benign Het
Tas2r120 A T 6: 132,657,609 Q218L probably benign Het
Tbx15 A G 3: 99,351,874 T354A possibly damaging Het
Trim24 A G 6: 37,958,677 T868A probably benign Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr20rt T A 12: 65,226,233 W56R probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp64 G A 2: 168,926,742 H317Y probably damaging Het
Other mutations in Zfp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Zfp40 APN 17 23175742 missense probably benign 0.18
IGL02664:Zfp40 APN 17 23176986 missense probably benign 0.14
IGL02729:Zfp40 APN 17 23178311 missense probably damaging 0.99
R1288:Zfp40 UTSW 17 23182162 missense probably benign 0.01
R1450:Zfp40 UTSW 17 23175258 missense probably benign 0.15
R1535:Zfp40 UTSW 17 23175869 missense probably damaging 1.00
R1655:Zfp40 UTSW 17 23177266 missense probably benign 0.01
R1797:Zfp40 UTSW 17 23175540 missense possibly damaging 0.93
R3764:Zfp40 UTSW 17 23177127 missense possibly damaging 0.49
R4356:Zfp40 UTSW 17 23177190 missense probably benign 0.15
R4402:Zfp40 UTSW 17 23176719 missense possibly damaging 0.49
R4781:Zfp40 UTSW 17 23175655 missense probably damaging 0.99
R4792:Zfp40 UTSW 17 23177034 missense possibly damaging 0.79
R6142:Zfp40 UTSW 17 23176337 missense probably benign 0.40
R6179:Zfp40 UTSW 17 23178380 missense possibly damaging 0.51
R6759:Zfp40 UTSW 17 23176536 missense possibly damaging 0.95
R7294:Zfp40 UTSW 17 23176437 missense possibly damaging 0.60
X0022:Zfp40 UTSW 17 23177154 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGTTGTCTCTAGATAGATCAAAGAGC -3'
(R):5'- GCCCTCAAAGTATGTTAATTGTGAGTC -3'

Sequencing Primer
(F):5'- GGATGAGGGAGGAATTCTAT -3'
(R):5'- TGGGTTTTCCAGAAGATCAACCAG -3'
Posted On2014-10-16